Labshake search
Citations for Promega :
1 - 50 of 1165 citations for RT qPCR Master Mixes since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... RT-qPCR using GoTaq qPCR Master Mix (Promega) was performed on a QuantStudio7 Flex (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR was performed using GoTaq qPCR Master Mix (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... RT-qPCR was performed using GoTaq qPCR Master mix (Promega). Cycling conditions were as follows ...
-
bioRxiv - Developmental Biology 2024Quote: ... RT-qPCR was performed using GoTaq qPCR SYBR Green Master Mix (Promega). GAPDH was used as an endogenous control (primer details are listed in Supplementary Table 3).
-
bioRxiv - Molecular Biology 2021Quote: ... for RT-PCR and GoTaq qPCR Master Mix (Promega) for RT-qPCR ...
-
bioRxiv - Genetics 2023Quote: ... GoTaq Master Mixes (Promega, Wisconsin, United States) were used according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... All RT-qPCRs were done using the GoTaq qPCR Master Mix (Promega, A6002) in a CFX384 real-time PCR detection system (Bio-Rad) ...
-
bioRxiv - Pathology 2020Quote: ... GoTaq® Hot Start Master Mixes 2x (Promega), specific primers (5’ CGCATATGATGGAGCACGTGCA 3’ and 5’ CGGGATCCCTACAGTTTGGCG ...
-
bioRxiv - Immunology 2022Quote: ... and RT-qPCR analysis was performed with GoTaq qPCR Master Mix (Promega, Madison, WI). Triplicate samples were quantified using the QuantStudio 5 software (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2024Quote: ... RT-qPCR assays were performed with the GoTaq qPCR Master Mix (Promega, Madison, USA). Two genes ...
-
bioRxiv - Developmental Biology 2020Quote: ... Each quantitative RT-qPCR reaction was performed using the GoTaq qPCR Master Mix kit (Promega). For a 10 μl reaction ...
-
bioRxiv - Molecular Biology 2023Quote: ... SYBR Green-based RT-qPCR reactions were set up using GoTaq qPCR Master Mix (Promega) and 20 ng of input cDNA per each 10-μL reaction ...
-
bioRxiv - Microbiology 2019Quote: ... PCR was performed by using GoTaq Master Mixes (Promega) with the following conditions ...
-
bioRxiv - Genetics 2022Quote: ... 10 μl 2x GoTaq® Master Mixes (Promega, M7123), and 6 μl water ...
-
bioRxiv - Developmental Biology 2019Quote: ... RT-qPCR was performed with GoTaq® qPCR Master Mix for Dye-Based Detection (Promega, A6001) using a CFX Connect Bio-Rad qPCR System ...
-
bioRxiv - Cancer Biology 2021Quote: ... Real-time quantitative PCR (RT-qPCR) was performed with GoTaq qPCR Master Mix (Promega; Cat#: A6002). Gene expression analysis was calculated following normalization to PPAI using the comparative Ct (cycle threshold ...
-
bioRxiv - Cell Biology 2022Quote: ... SYBR Green-based RT-qPCR reactions were set up using the GoTaq qPCR Master Mix (Promega) and 20 ng input cDNA per each 10-μL reaction ...
-
bioRxiv - Plant Biology 2024Quote: ... Real-time quantitative PCR (RT-qPCR) was performed using the GoTaq QPCR Master Mix (Promega, A6001) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Quantitative RT-PCRs were performed with the GoTaq qPCR Master Mix (Promega), 2% of cDNA per reaction ...
-
bioRxiv - Molecular Biology 2024Quote: ... RT-qPCR was performed using SYBR Green PCR Master Mix (A6002, Promega) with the gene-specific primers (Table S9) ...
-
bioRxiv - Cell Biology 2019Quote: ... RT-PCR reactions were conducted using the GoTaq qPCR Master Mix (A6001, Promega) and a MasterCycler Ep-Realplex thermal cycler (Eppendorf).
-
bioRxiv - Neuroscience 2020Quote: ... RT-PCR was performed using GoTaq® qPCR Master Mix (Promega, Shanghai, China) and specific primers (Sangon Biotech ...
-
bioRxiv - Cell Biology 2022Quote: ... RT-PCR was then performed using the SYBR Green qPCR Master Mix (Promega). Primer sequences are available upon request ...
-
bioRxiv - Neuroscience 2020Quote: ... RT-qPCR was performed on the ViiA 7 Real-Time PCR System using GoTaq qPCR master mix (Promega) according to the manufacturer’s protocols ...
-
bioRxiv - Physiology 2021Quote: ... The resultant cDNA was assessed by RT-qPCR using SYBR® Green Supermix 2x qPCR master mix (Promega) in a ABI PRISM 7900HT Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2023Quote: ... The resulting cDNA was analyzed by RT-qPCR using SYBR green fluorescent dye 2x qPCR master mix (Promega) in a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Physiology 2024Quote: ... The resulting cDNA was analyzed by RT-qPCR using SYBR green fluorescent dye 2x qPCR master mix (Promega) in a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems) ...
-
Identification of echinacoside as a tobramycin potentiator against Pseudomonas aeruginosa aggregatesbioRxiv - Microbiology 2024Quote: ... Such cDNA samples were applied as templates for RT-qPCR using 2× GoTaq® qPCR Master Mix (Promega). The reactions were performed on the CFX96TM system (BIO-RAD ...
-
bioRxiv - Neuroscience 2020Quote: ... Gene expression analysis was done by RT-PCR (GoTaq qPCR Master Mix, Promega, USA) using gene specific primers (Suppl ...
-
bioRxiv - Neuroscience 2020Quote: ... Quantitative RT-PCR was performed in triplicates with the GoTaq qPCR Master Mix (Promega) on a LightCycler 480 II PCR system (Roche ...
-
bioRxiv - Developmental Biology 2023Quote: ... with 1 ug of RNA and RT-qPCR reactions were performed using GoTaq® qPCR Master Mix (A6002 - Promega). Analyses were carried out in the QuantStudio™ 5 Real-Time PCR System ...
-
bioRxiv - Neuroscience 2021Quote: RT-qPCR was conducted using one-step RT-qPCR kit (Promega, A6020), according to manufacturer instructions ...
-
bioRxiv - Microbiology 2023Quote: ... RT-qPCR reactions using the GoTaq 1-Step RT-qPCR kit (Promega) were set-up to 10 µl final reaction volumes according to the manufacturer’s instructions containing 250 nM of each receptors primer pairs and 10 ng of RNA ...
-
bioRxiv - Plant Biology 2020Quote: ... The concentrations of the resulting cDNAs were adjusted to 10 ng/µL and 2 µL were used for RT-qPCR reactions performed with the GoTaq qPCR Master Mix (Promega) in a final volume of 10 µL ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and gene expression levels measured using a 1-step RT-qPCR master mix (Promega, UK) and a 7500 Fast qPCR instrument (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2024Quote: Quantitative real-time PCR (RT-qPCR) was performed using GoTaq PCR Master Mix (Promega, #A6002) and specific primers listed below ...
-
bioRxiv - Cancer Biology 2023Quote: ... Quantitative RT-PCR was performed with GoTaqβ qPCR and RT-qPCR Systems (Promega) on a CFX384 Real-time System (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... RT-qPCR was performed using the GoTaq 1-step RT-qPCR system (Promega). Knockdowns were verified using primers described in Table I ...
-
bioRxiv - Microbiology 2020Quote: ... PCR amplification was performed using GoTaq® G2 master mixes DNA polymerase (Promega) with the following primer pairs ...
-
bioRxiv - Molecular Biology 2022Quote: ... GoTaq® qPCR and RT-qPCR Systems (Promega), and reverse transcription system (Promega) ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative RT-PCR (qPCR) reactions were conducted in a 10-µL total volume using a 2× GoTaq® qPCR Master Mix (Promega) and run on an ABI 7500 qPCR thermocycler (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2021Quote: ... RT-qPCR assays were carried out in triplicate using SYBR® Green chemistry with GoTaq® qPCR Master Mix (Promega, UK) on a StepOne™ Real-Time PCR Machine (Applied Biosystems ...
-
bioRxiv - Immunology 2022Quote: ... Target gene expression was determined by quantitative RT-PCR using GoTaq qPCR Master mix (Promega, A6002) on a QuantStudio 5 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR was performed using the GoTaq® 1-Step RT-qPCR System (Promega). Knockdowns were verified using the primers ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed using the GoTaq® 1-Step RT-qPCR System (Promega) with an input of 50 ng RNA ...
-
bioRxiv - Cancer Biology 2024Quote: ... RT-qPCR was performed using the GoTaq® 1-Step RT-qPCR System (Promega) with an input of 50 ng RNA ...
-
bioRxiv - Cell Biology 2021Quote: ... AtLPAAT4 and AtLPAAT5 by RT-qPCRs were performed with the Bio-Rad CFX96 real-time system using GoTaq® qPCR Master mix (Promega # A6002). The specific primer pairs used for AtLPAAT2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and qPCR using GoTaq qPCR Master Mix (Promega) on a qTower (Analytik Jena).
-
bioRxiv - Biochemistry 2021Quote: ... Quantitative RT-PCR was performed using GoTaq® Probe qPCR and RT-qPCR Systems (Promega) in a StepOne™ Real-Time PCR System (Thermo Fisher) ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative RT-PCR was performed using GoTaq® Probe qPCR and RT-qPCR Systems (Promega) in an StepOne(tm ...