Labshake search
Citations for Promega :
1601 - 1650 of 3646 citations for 5M Betaine Solution PCR Grade since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... Samples were then dried and resuspended in 50 mM ammonium bicarbonate and incubated with sequencing-grade modified trypsin (Promega, Cat. No. V5113) in a 1:20 enzyme:sample ratio overnight at room temperature ...
-
Ethanolamine-induced assembly of microcompartments is required for Fusobacterium nucleatum virulencebioRxiv - Microbiology 2024Quote: ... They were then diluted 5-fold with aqueous 50 mM TEAB and incubated overnight with Sequencing Grade Modified Trypsin (1 µg in 10 µl of 50 mM TEAB; Promega, Madison, WI) following which an equal volume of ethyl acetate/trifluoroacetic acid (TFA ...
-
bioRxiv - Molecular Biology 2024Quote: One hundred micrograms of urinary proteins from each sample were digested with trypsin (Trypsin Gold, Mass Spec Grade, Promega, Fitchburg, WI, USA) using filter-aided sample preparation (FASP ...
-
bioRxiv - Plant Biology 2024Quote: ... The samples were diluted by the addition of 7 volumes of 25mM Tris-HCl pH 8.0 and sequencing-grade modified Trypsin (Promega Corp., Madison, WI) was added (0.4 μg/ sample ...
-
bioRxiv - Developmental Biology 2024Quote: ... then both soluble and insoluble protein lysates were reduced with 5 mM dithiothreitol and further alkylated with 15 mM iodoacetamide and processed for overnight digestion at 37°C in S-Trap columns (Protifi) using a Sequencing Grade Modified Trypsin (Promega, Catalog # V5111). The peptide mixtures were eluted from the columns ...
-
bioRxiv - Bioengineering 2020Quote: ... Homozygous lpat2-3 T-DNA insertional mutants were identified by PCR using Promega PCR Master Mix (Promega) and combinations of the gene specific and T-DNA left border primers pairs ...
-
bioRxiv - Microbiology 2020Quote: ... The dcas9 PCR amplicon was purified using a Wizard SV Gel and PCR Clean-up kit (Promega) and digested with AscI and HindIII ...
-
bioRxiv - Microbiology 2020Quote: ... PCR product was then purified using the Wizard® SV Gel and PCR Clean-up System (Promega) and quantified using NanoDrop™ technology ...
-
bioRxiv - Cancer Biology 2021Quote: ... containing Proteinase K and target regions were amplified by PCR using the GoTaq G2 PCR mastermix (Promega). Correct and unique amplification of the target regions was verified by agarose gel electrophoresis before purifying PCR products using the QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Cell Biology 2022Quote: ... The PCR products were purified using the Wizard SV Gel and PCR Clean-up System (A9281, Promega) and the purified templates were used to produce single stranded digoxigenin (DIG)-labelled RNA probes with the T7 (P2075 ...
-
bioRxiv - Developmental Biology 2021Quote: ... a 725bp segment of the Svep1 transcript (NM_153366.4; 746-11179) was PCR amplified (PCR Master Mix, Promega) with one pair of exon-exon boundary overlapping primers (5’ TGTGGTCCTCCAAGTCACGTA 3’ ...
-
bioRxiv - Immunology 2020Quote: ... The PCR fragment was cleaned up using the Wizard SV Gel and PCR Clean-up System (Promega). The fragment was digested with EcoRI-HF and HindIII-HF (New England Biolabs ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Primers and remnants of the PCR reaction were removed using the Wizard PCR cleanup kit (Promega, USA). The concentration of the purified DNA was determined using an ND-2000 NanoDrop spectrophotometer ...
-
bioRxiv - Cancer Biology 2020Quote: ... The PCR product was run on the agarose gel and purified using PCR purification kit (A1222, Promega). The Alu PCR product was cloned into using pGEM-T Easy Vector (A1380 ...
-
bioRxiv - Immunology 2021Quote: ... containing Proteinase K and target regions were amplified by PCR using the GoTaq G2 PCR mastermix (Promega). Correct and unique amplification of the target regions was verified by agarose gel electrophoresis before purifying PCR products using the QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Plant Biology 2024Quote: ... The second PCR products were purified using the Wizard SV Gel and PCR Clean-up System (Promega) and the Agencourt AMPure XP Kit (Beckman Coulter) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... PCR products were purified using the Wizard PCR Cleanup and Gel Purification system (Promega, Fitchburg, WI, USA).
-
bioRxiv - Molecular Biology 2023Quote: ... PCR amplicons were purified using the Wizard® SV Gel and PCR Clean-Up System kits (Promega), followed by Sanger sequencing (Eurofins) ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR products were purified using “Wizard® SV Gel and PCR Clean-Up System” (Promega, USA). The obtained RT-PCR fragments were next digested with BsmBI-v2 (NEB ...
-
bioRxiv - Developmental Biology 2024Quote: ... The PCR product was then purified and recovered using GeneJET PCR Purification Kit (Promega, Madison, WI, USA). Then the purified product was ligated with pLB vector (Tiangen ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products (1.5Kb) of 16S rRNA gene were cleaned with Gel and PCR Clean-Up system (Promega, USA), and quantified by NenoDrop ...
-
bioRxiv - Developmental Biology 2021Quote: ... PCR products were purified using a Wizard SV Gel and PCR Clean-Up System (Promega, Madison, WI, USA) kit ...
-
bioRxiv - Developmental Biology 2021Quote: ... PCR products were purified using a Wizard SV Gel and PCR Clean-Up System (Promega, Madison, WI, USA) kit for Sanger sequencing.
-
bioRxiv - Microbiology 2020Quote: ... PCR products were pooled and purified with Wizard Gel and PCR Clean-up Kit (Promega, Madison, Wisconsin, USA). Purified PCR products were sequenced at Michigan State University ...
-
bioRxiv - Microbiology 2022Quote: ... After purification of the PCR product with Wizard® SV Gel and PCR Clean-Up System (Promega, UK), the arsM amplicon was sequenced at Microsynth (Balgach ...
-
bioRxiv - Microbiology 2021Quote: ... Positive constructs were identified by colony PCR using the segment-specific PCR primers and Taq green mastermix (Promega) with the following cycle profile ...
-
bioRxiv - Cancer Biology 2022Quote: ... Wizard® SV Gel and the PCR Clean-up System were used to clean the PCR products (Promega). Next ...
-
bioRxiv - Cancer Biology 2023Quote: ... All PCR reactions were run using 2 µL of extracted DNA in GoTaq® PCR Master Mix (Promega) and the following cycling protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... The PCR product was cleaned using the Wizard SV Gel and PCR Clean-Up System (Promega, Madison, WI), and samples were submitted to the Roy J ...
-
bioRxiv - Cancer Biology 2020Quote: ... The mixture was added with 25 mM NH4HCO3 to dilute urea to 1 M followed by overnight digestion with sequencing-grade trypsin (Promega, Madison, WI, USA) at an enzyme/protein ratio of 1:40 (wt/wt ...
-
bioRxiv - Plant Biology 2020Quote: ... approximately 0.6 mg IgG-enriched proteins were first digested on the beads with mass spectrometry-grade Trypsin/Lys- C Mix (Promega, Madison, WI, USA) at a 1:50 (enzyme/substrate ...
-
bioRxiv - Systems Biology 2020Quote: ... TFE was then diluted to 25% with 50mM ABC, LysC (Wako Chemicals, 1:100 lysC:protein ratio) and sequencing-grade modified trypsin (Promega, 1:50 trypsin:protein ratio) was added and incubated overnight at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... TFE was then diluted to 25% with 50 mM ABC, LysC (Wako Chemicals, 1:100 lysC:protein ratio) and sequencing-grade modified trypsin (Promega, 1:50 trypsin:protein ratio) was added and incubated overnight at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... The samples were then diluted to a final guanidine chloride concentration of 1 M with 100 mM ammonium bicarbonate and digested with sequencing grade porcine trypsin (Promega, 1:100 trypsin:protein) for 22 h at 37° C ...
-
bioRxiv - Immunology 2020Quote: ... washed beads were then resuspended in 35 μL of ammonium bicarb buffer to which 1 μL sequencing grade porcine trypsin was added (Promega, Cat. No. V5111). Immune complexes were digested on bead for 1 hr at 37°C ...
-
bioRxiv - Plant Biology 2021Quote: ... The samples after pull-down assay and co-immunoprecipitation were also digested by 1 µg sequence-grade modified trypsin (Promega, Madison, WI, USA) at 37 °C overnight in the same manner ...
-
bioRxiv - Cancer Biology 2021Quote: ... The samples were next reduced with DTT and alkylated with iodoacetamide and subsequently digested in the presence of sequencing grade LysC (Wako) and Trypsin (Promega, Fitchburg, WI, USA). Finally the acidified tryptic digests were desalted on home-made 2 disc C18 StageTips as described 50 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and digested with trypsin at an enzyme-to-substrate ratio of 1:50 (wt/wt, modified sequencing grade, Promega, Madison, Wisconsin. United States) for 16 hours at 30°C ...
-
bioRxiv - Developmental Biology 2023Quote: Dry IgG was redissolved in 25 µL 25 mM ammonium bicarbonate and digested with 0.2 µg sequencing grade modified trypsin (Promega Corp., Madison WI, USA) at 37 °C overnight ...
-
bioRxiv - Molecular Biology 2023Quote: ... The resulting proteins with carbamidomethyl groups on their cysteines were digested with 300 ng of sequencing-grade porcine trypsin (Promega, Fitchburg, MA, USA) and injected on an Easy-nanoLC-1000 system coupled to a Q-Exactive+ mass spectrometer (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... Proteins were then solubilized in 50 mM ammonium bicarbonate for a reduction-alkylation step (dithiothreitol 5 mM – iodoacetamide 10 mM) and an overnight digestion with 300ng of sequencing-grade porcine trypsin (Promega, Fitchburg, MA, USA). Digested peptides were resuspended in 0.1% formic acid (solvent A ...
-
bioRxiv - Systems Biology 2023Quote: ... at the ratio of 1:50 for 3 h at 37°C and then using trypsin (sequencing grade modified trypsin; Promega, Fitchburg, WI, USA) at the ratio of 1:50 at 37°C overnight (for 15 h to 18 h ...
-
bioRxiv - Cell Biology 2023Quote: Affinity purified proteins retained on beads were resuspended in 100 µL of NH4HCO3 at 25 mM containing 2 µg of Trypsin/Lys-C mix (Mass Spec Grade, Promega, Madison, WI, USA). Digestion was performed under agitation at 37°C during 4h ...
-
bioRxiv - Biochemistry 2023Quote: ... each sample was hydrolyzed to 100 µg of protein in a 50: 1 ratio using trypsin (trypsin Gold, MassSpec Grade, Promega, Fitchburg, WI, USA). After enzymolysis at 37 for 14 h ...
-
bioRxiv - Microbiology 2024Quote: ... Peptide digestion was initiated by adding 25 µL of 50 mM ammonium bicarbonate buffer (pH 8) containing 2 µg trypsin (Sequencing Grade Modified Trypsin, Promega, Cat. no. V5117) directly on top of the column and incubating overnight at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... was added and samples were digested for two hours at 37°C followed by addition of 1 μg of sequencing-grade Trypsin (Promega, Ref. No. V5113) and digestion overnight at 37°C ...
-
bioRxiv - Biochemistry 2024Quote: ... The urea concentration in the lysate was reduced to 2 M with the addition of 50 mM NH4HCO3 and the samples were subjected to overnight trypsin digestion (Trypsin Gold, MS Grade, Promega Corporation, WI, USA). Following digestion ...
-
bioRxiv - Molecular Biology 2024Quote: ... pH 8.5 to a final urea concentration of 2 M for Trypsin/Lys-C based overnight protein digestion at 37 °C (0.5 µg protease, Mass Spectrometry grade, Promega Corporation, Cat No: V5072.)
-
bioRxiv - Molecular Biology 2024Quote: ... and digested with Lys-C (1/200 weight of protein; Fujifilm Wako) and sequencing grade modified trypsin (1/100 weight of protein; Promega, Madison, WI, USA) at 37 °C overnight in 0.1 % Rapigest ...
-
bioRxiv - Cancer Biology 2024Quote: ... Tryptic digestion was performed by the addition of sequencing-grade modified trypsin (Promega; 25 µL of 10 ng/mL in 50 mM NH4HCO3) and overnight incubation at 37°C ...