Labshake search
Citations for Promega :
101 - 150 of 3827 citations for Human Bcl2 Associated Death Promoter BAD ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2024Quote: ... this regulatory sequence was constructed into a pGL3-promoter vector (Promega), which contains the SV40 enhancer and firefly luciferase ...
-
bioRxiv - Genetics 2024Quote: The promoterless pGL4.10[luc2] firefly luciferase promoter was purchased from Promega, and linearized using the XhoI restriction enzyme at the multiple cloning site ...
-
bioRxiv - Genomics 2024Quote: ... We used pRL-TK Renilla vector with thymidine kinase promoter (Promega) as a control vector ...
-
bioRxiv - Molecular Biology 2022Quote: Activity of predicted labor-associated TF candidates was assayed using a dual luciferase reporter assay (Promega). On Day 0 ...
-
bioRxiv - Molecular Biology 2023Quote: Activity of predicted labor-associated TF candidates was assayed using a dual luciferase reporter assay (Promega) as done previously (8) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Cell death was assessed using propidium iodide staining and the LDH-Glo Cytotoxicity Assay (Promega, Cat #J2380). For the propidium iodide staining ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The lactate dehydrogenase (LDH) quantification was performed with centrifuged BAL supernatant to evaluated cell death (CytoTox96, Promega, USA). Differential cell counts were performed by cytospin (Cytospin3 ...
-
bioRxiv - Immunology 2020Quote: ... Cell death after 5 h treatment was quantified by PI incorporation or using the Caspase Glo system (Promega) according to manufacturer instructions.
-
bioRxiv - Microbiology 2021Quote: Peptides from cell-surface/biofilm-ECM-associated proteins were released via a Trypsin/Lys-C mix (Promega) at a final concentration of 50 ng µL-1 ...
-
bioRxiv - Microbiology 2021Quote: ... a vector that harbors T7 and SP6 promoter (Promega, Madison, WI, USA). NA and NP RNA were synthesized using a HiScribe T7 in vitro transcription kit (New England BioLabs ...
-
bioRxiv - Microbiology 2021Quote: ... promoter activity was measured with Dual-Luciferase® Reporter Assay System (Promega). The relative firefly luciferase activities are normalized to the Renilla luciferase.
-
bioRxiv - Genetics 2021Quote: ... and cloned into upstream of the minimal promoter in pGL4.23 (Promega, E841A) with XhoI and BglII ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Promoter activity (firefly luciferase) was determined by Dual-Glo luciferase assay (Promega) following manufacturer specifications ...
-
bioRxiv - Immunology 2024Quote: ... renilla luciferase under a CMV promoter is commercially available from Promega (Promega). pIFNβ-Luc contains the murine IFNβ promoter ligated into pGL3basic (Promega ...
-
bioRxiv - Molecular Biology 2023Quote: ... Putative promoter sequences were digested and ligated into pGL-4.79 [Rluc] (Promega), a Renilla luciferase reporter construct lacking a promoter.
-
bioRxiv - Molecular Biology 2023Quote: ... TK-minimal promoter was excised from pRL-TK (Promega, Madison, Wisconsin, USA) using BglII/HindIII restriction enzymes and instered into corresponding sites of pGL4.12 (Promega ...
-
bioRxiv - Bioengineering 2024Quote: ... an EF1A core promoter followed by attB* and Firefly luciferase-PEST (Promega) with an SV40 polyadenylation signal ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... These CNE fragments were inserted into the pGL4-promoter vector (Promega, USA) and sequenced (TsingKe Biotech ...
-
bioRxiv - Cell Biology 2023Quote: ... A direct cAMP ELISA kit (Enzo) was used in endpoint experiments and the pGloSensor (−20F) luminescence assay (Promega) was used for kinetic cAMP measurements ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Chemical-mediated cell death was assessed using the colorimetric CytoTox 96® Non-Radioactive Cytotoxicity Assay (Promega, Cat#: G1780), which measures lactate dehydrogenase (LDH ...
-
bioRxiv - Microbiology 2020Quote: ... Light signals derived from reconstituted HiBiT/LgBiT association were measured using Tristar multiwell luminometer (Berthold Technology, Bad Wildbad, Germany) for 2.5 seconds by adding 20 µl of Nano-Glo® substrate (Promega Inc, WI, USA; diluted 1:40 in PBS). Mock-infected cells served as controls to determine basal luciferase activity for obtaining normalized relative light units in infected samples ...
-
bioRxiv - Microbiology 2020Quote: ... The cells were then incubated at 37 °C in tissue culture incubator for 4 hours or 24 hours before measuring reconstituted HiBiT/LgBiT activity using a Tristar multiwell Luminometer (Berthold Technology, Bad Wildbad, Germany) for 2.5 seconds by adding 20 µl of Nano-Glo® substrate (Promega Inc, WI, USA; diluted 1:40 in PBS). Individual unmixed populations of cells were treated identically and served as controls to determine basal luciferase activity to obtain normalized relative light units ...
-
bioRxiv - Plant Biology 2021Quote: ... and the TnT® Quick Coupled Transcription/Translation System (for T7 promoter, Promega) according to the manufacturers protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... and a Renilla luciferase reporter plasmid driven by a constitutive CMV promoter (Promega). 24 hours later ...
-
bioRxiv - Molecular Biology 2020Quote: The mtTFs promoter-reporter constructs were generated in the pGL3Basic vector (Promega, USA). The resultant plasmids were sequenced for confirmation ...
-
bioRxiv - Microbiology 2021Quote: ... and 2.5ng of a Renilla luciferase under control of thymidine kinase promoter (Promega), as a control for transfection ...
-
bioRxiv - Immunology 2021Quote: ... Luciferase promoter activity was determined using the Dual-Luciferase Reporter Assay System (Promega) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... the TK-minimal promoter was removed from pRL-TK (Promega, Madison, Wisconsin, USA) and inserted into the appropriate locations of pGL4.12 (Promega ...
-
bioRxiv - Genetics 2023Quote: ... or minimal promoter firefly luciferase reporter plasmid pGL4.26 [luc2/miniP/Hygro] (Promega, #E8441). Note ...
-
bioRxiv - Genetics 2023Quote: ... Promoter region of IGF2BP1 was cloned into the PGL3-Basic luciferase vector (Promega) that was subjected to transfection into DF-1 cell line (chicken fibroblast cell ...
-
bioRxiv - Cell Biology 2021Quote: ... Cell death was measured 24 hours post seeding via luminescence using the Caspase Glo assay (Promega, Madison, WI, USA: #G8090). Annexin-V /7AAD staining (Biolegend ...
-
bioRxiv - Immunology 2022Quote: Lytic cell death was determined by measuring LDH release from cell-free supernatants using a colorimetric assay (Promega or Takara) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were incubated for three days before assessing viability and virus-induced cell death by CellTiter Glo according to manufacturer protocol (Promega). Luminescence was quantified using a plate reader (Cytation 5 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The promoter was amplified with primers XI6247/XI6248 and cloned into pGEM-Teasy (Promega) to create pCB4594 ...
-
bioRxiv - Biochemistry 2021Quote: ... 40 ng ml-1 of Renilla luciferase under a constitutive promoter (pRL-TK, Promega), and 40 ng ml-1 of pLEXm vector (34 ...
-
bioRxiv - Immunology 2021Quote: Cxcl1 promoter region from nucleotide −157 to +283 was cloned into pGL3-basic (Promega) through KpnI and BglII cloning sites using the following primers:
-
bioRxiv - Neuroscience 2022Quote: ... and cloned into pGL3-Firefly luciferase upstream of the SV40 promoter (pGL3-luc; Promega) using a Gibson assembly kit (New England BioLabs ...
-
bioRxiv - Genetics 2020Quote: Reporter vectors were constructed in the pGL3-Promoter luciferase vector (Promega; GenBank Accession # U47298). The desired enhancer regions spanning the 4C interaction (chr15:91,504,893-91,507,207 ...
-
bioRxiv - Physiology 2023Quote: ... and promoter activity was measured by a dual luciferase system using firefly luciferase (Promega) normalized to Renilla luciferase (coelenterazine ...
-
bioRxiv - Genomics 2023Quote: ... These sequences were inserted into the hPGK promoter of the luciferase plasmid pGL4.53 (Promega) using Gibson assembly ...
-
bioRxiv - Immunology 2024Quote: The mouse Il12b promoter (−355 to +55) was cloned into the pGL4.10 vector (Promega). Motif mutations were introduced using the GENEART site-directed mutagenesis system (Invitrogen) ...
-
bioRxiv - Developmental Biology 2023Quote: Carm1 promoter region (-630 to +15) was cloned to pGL4 luciferase reporter vector (Promega) to be the Carm1-reporter ...
-
bioRxiv - Neuroscience 2023Quote: ... miR153 Upstream Seq HindIII R: TATATAAAGCTTCTAAGTAGCTGGCAAAGT) of promoter-less pGL4.10 Firefly luciferase construct (Promega), and the NFAT binding site mutated via site directed mutagenesis (miR153 NFAT Mut F ...
-
bioRxiv - Genetics 2023Quote: ... A Thymidine Kinase (TK) promoter-driven Renilla luciferase plasmid pGL4.74 [hRluc/TK] (Promega, #E6921) was used as a transfection efficiency control.
-
bioRxiv - Genomics 2022Quote: ... containing a minimal CMV-promoter for enhancer-assays or pGL4.15[luc2P/Hygro] (Promega, E6701) w/o any promoter for promoter-assays were first digested using EcoRV (New England Biolabs ...
-
bioRxiv - Microbiology 2024Quote: ... Promoter activity was measured using the Promega Dual-Luciferase Reporter Assay System (Promega, E1910) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... The PCR product was then cloned into the TOPO II dual promoter vector (Promega) and the riboprobe synthesized (linearized with SpeI ...
-
bioRxiv - Cell Biology 2021Quote: Apoptotic cell death was measured in a 96-well format using the RealTime-Glo™ Annexin V Apoptosis and Necrosis Assay (Promega) per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: Release of LDH in the cell supernatant was assessed as a marker of cell death in male and female PTECs using the CytoTox96® Cytotoxicity Assay (Promega) following the manufacturer instructions (see Supplemental Methods).
-
bioRxiv - Neuroscience 2023Quote: Cell death was evaluated in 30 day-old non-embedded organoids using LDH-Glo™ Cytotoxicity Assay (Promega, cat. no J2380) accordingly to the manufacturer’ instructions ...