Labshake search
Citations for Promega :
1 - 50 of 3827 citations for Human Bcl2 Associated Death Promoter BAD ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... The labor-associated endogenous gene promoters were cloned into the pGL4.23 backbone (Promega) either directly from gDNA (using overhang-containing primers ...
-
bioRxiv - Microbiology 2022Quote: ... and associated Maxwell RSC cultured cells DNA kit (Promega). DNA concentration was quantified using the Qubit 3.0 fluorometer for dsDNA broad range assay kit (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 830bp or 800bp human STIM1 promoter into pGL3 basic vector (Promega) between XhoI and HindIII ...
-
bioRxiv - Cancer Biology 2024Quote: ... 800bp or 300bp human HNF4α promoter into pGL3 basic vector (Promega) between XhoI and HindIII ...
-
bioRxiv - Cancer Biology 2020Quote: 2000bp human lncRNA-TANAR(ENST00000425110.1) promoter was cloned into PGL3 basic vectors (Promega). By mutating the crucial site of AR binding site in the lncRNA-TANAR 5’ promoter to EcoRI cutting site (-GAATTC) ...
-
bioRxiv - Immunology 2020Quote: BMDMs cell death was determined using LDH Cytotoxicity Detection Kit (Promega, Cat#G1780). Briefly ...
-
bioRxiv - Immunology 2020Quote: ... Non-radioactive cytotoxicity kit for determination of cell death was obtained from Promega Corporation ...
-
bioRxiv - Systems Biology 2024Quote: ... Cells were transfected with the human FOXM1 promoter (19) and Renilla (pRL-TK, Promega) as an internal transfection control using Lipofectamine LTX (#15338100 ...
-
bioRxiv - Genomics 2024Quote: ... The human promoters HSPA1A and DHDH were cloned into the pGL4.12 vector (Promega, #E6671) at the BglII and HindIII restriction sites ...
-
bioRxiv - Microbiology 2021Quote: Cell death were measured using CytoTox 96 Non-Radioactive Cytotoxicity Assay kit (Promega, G1780) according to the lactate dehydrogenase (LDH ...
-
bioRxiv - Molecular Biology 2020Quote: ... WT or mutant promoter of human Rpl28 gene was cloned into pGL-3-basic (Promega, E1751). The number is relative to transcriptional start site ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human and murine NLRC5 and CXCL10 promoters were cloned into pGL3 basic luciferase reporter vector (Promega). All mutated plasmids were constructed from wild type plasmids by Fast Mutagenesis System (TransGen Biotech) ...
-
bioRxiv - Biochemistry 2023Quote: ... cell death was measured using the CellTiter-Glo 2.0 luminescent cell viability assay kit (Promega), and the virus volume condition (100 uL ...
-
bioRxiv - Molecular Biology 2023Quote: Cell death was quantified using a lactate dehydrogenase (LDH) assay kit (Promega; Madison, WI, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... Cell death was determined with CytoTox 96® Non-Radioactive Cytotoxicity Assay kit (G1780, Promega).
-
bioRxiv - Molecular Biology 2021Quote: ... pGL3-promoter (Promega) vector (pGL3-Promoter Vector GenBank® Accession Number U47298 ...
-
bioRxiv - Cancer Biology 2021Quote: Each enhancer or promoter region was amplified from human genomic DNA and cloned into pGL4.10 [luc2] (Promega) containing a SNP (rs718960 ...
-
bioRxiv - Biochemistry 2023Quote: ... cell death was measured using the CellTiter-Glo 2.0 (CTG) luminescent cell viability assay kit (Promega).
-
bioRxiv - Microbiology 2023Quote: Promoter assays were performed using Dual-Glo Luciferase Assay Systems kit (Promega) according to manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... pGL3- Promoter (Promega, E1761), and pGL3-basic (Promega ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cell death was measured by the LDH assay using CytoTox 96 Non-Radioactive Cytotoxicity Assay kit (Promega).
-
bioRxiv - Molecular Biology 2021Quote: ... The PCR products were cloned using promoter-less pGL3-basic (pB) vector or pGL3-promoter (pP) vector containing a SV40 promoter (Promega Corporation) and Gibson Assembly (New England BioLabs) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The promoter area of human Rpl28 gene was cloned at HindIII/NcoI site of the pGL3-basic (Promega, E1751) to make pGL3-reporters ...
-
bioRxiv - Cancer Biology 2023Quote: IDH1 and NNT promoter sequences were amplified from genomic DNA of human primary melanocytes by PCR and cloned into pGL4.12 (Promega). Mutagenesis of E-boxes was performed using a QuikChange Site-Directed Mutagenesis Kit (Stratagene) ...
-
bioRxiv - Biophysics 2022Quote: ... pHalo-SMARCA4 expresses human SMARCA4 with HaloTag fused to the N-terminus under a CMVd1 promoter (Promega ORF FHC12075). pHalo-MED26 expresses human MED26 fused with a HaloTag at the N-terminus and was a kind gift from Joan Conaway’s lab ...
-
bioRxiv - Cancer Biology 2022Quote: TUNEL Cell death assays were performed following the instructions of DeadEnd™ Fluorometric TUNEL System kit (Promega, G3250). Briefly ...
-
bioRxiv - Microbiology 2021Quote: Cell death was assessed by the LDH assay using the CytoTox 96 Non-Radioactive Cytotoxicity Assay kit (Promega). Cell viability was determined by the CellTiter-Glo Luminescent Cell Viability Assay kit (Promega) ...
-
bioRxiv - Immunology 2024Quote: Cell death was analyzed by using a CellTiter-Glo Luminescent Cell Viability Assay Kit (Promega, Madison, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: The pGL3-Promoter Vector (Promega) was modified by replacement of the SV40 promoter by the Drosophila actin promoter from the pAct5.1/V5-His C vector (Thermo Scientific) ...
-
bioRxiv - Bioengineering 2020Quote: ... and 1 unit T4 ligase with associated buffer (Promega). The following thermocycler program was run ...
-
bioRxiv - Microbiology 2023Quote: ... Cell death was monitored using LDH-Glo Cyotoxicity Assay (Promega), CellToxGreen (Promega) ...
-
bioRxiv - Cancer Biology 2023Quote: ... cell death staining was done with the CellTox green (Promega) at a dilution of 0.25ul CellTox/500ul media for 20 min ...
-
bioRxiv - Physiology 2020Quote: The human HMGCS1 promoter was amplified (forward primer: GTCCATCGGAATTAGTTTAGCCTGTGC, reverse primer: CAATCGCGGCCGGTAGAGTTG) and cloned into the pGL3-Basic Vector (Promega). Full-length PTBP1 expression vector and control vector were purchased from OriGene (Cat ...
-
bioRxiv - Molecular Biology 2021Quote: ... Total genomic DNA extracted from liver mouse and HEK293 cells were used as templates for PCR-cloning of the mouse/human promoter/intron fragments into the KpnI/MluI sites of pGL3 basic luciferase reporter vector (Promega). The glutamic acid (E ...
-
bioRxiv - Microbiology 2021Quote: ... Cell death was determined according to the activity of lactate dehydrogenase (LDH) in supernatants using CytoTox® Kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... PCR products with low concentration or bad sequencing quality were cloned into pGEM-T Easy Vector (Promega) for sequencing ...
-
bioRxiv - Microbiology 2023Quote: The pGL3-promoter vector from Promega was used for firefly luciferase assays ...
-
Glycogen Synthase Kinase 3 regulates the genesis of the rare displaced ganglion cell retinal subtypebioRxiv - Neuroscience 2021Quote: ... Apoptosis was detected by terminal deoxynucleotidyl transferase-mediated biotinylated UTP nick end labeling (TUNEL) assays using in situ cell death detection kit (Promega). All images were acquired using a Zeiss LSM710 confocal microscope and Zen software (Zeiss).
-
bioRxiv - Cell Biology 2023Quote: ... Other parameters of ER Stress induced cell death were measured through immunoblotting or with the Caspase 3/7 Glo Assay Kit (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were incubated for 24hr at 37°C and cell death was measured through a lactate dehydrogenase (LDH) assay using the CytoTox 96 kit (Promega). 50 μL of media was collected from all experimental wells with two replicates each and placed in a fresh 96-well plate ...
-
bioRxiv - Immunology 2024Quote: ... The supernatants from cells stimulated with inflammasome activators were collected and subjected to lactate dehydrogenase (LDH) assay to assess cell death using a CytoTox 96 non-radioactive cytotoxicity assay kit (Promega). Both the supernatants and cell pellets were collected for immunoblotting analyses.
-
bioRxiv - Cancer Biology 2024Quote: ... and further validated in some experiments by measuring released LDH enzyme as a separate measure of cell death (CytotTox kit, Promega). To quantify phagocytosis of GFP-expressing GSCs ...
-
bioRxiv - Immunology 2024Quote: ... Cell death was assessed using the CytoTox 96 Cytotoxicity assay (Promega) and IL1β secretion measured by ELISA (Invitrogen).
-
bioRxiv - Cell Biology 2020Quote: ... MITF proximal promoter was cloned into SacI and HindIII sites of the PGL4 promoter vector (E6651, Promega). EVX_2xCRE promoter cloned into PGL456 was used to measure transcriptional activity of CRTC3 mutations found in melanoma patients ...
-
bioRxiv - Biophysics 2022Quote: pHalo-PPARγ2 expresses human PPARγ isoform 2 fused to HaloTag in the N-terminus under a CMVd1 promoter (Promega ORF clone #FHC08305). PPARγ2 mutants were generated by nucleotide substitution using the QuikChange II XL Site Directed Mutagenesis Kit (Stratagene ...
-
bioRxiv - Cell Biology 2023Quote: ... Necrosis was quantified by measuring release of lactate dehydrogenase in 30 µl samples of the medium and apoptosis by determining cell-associated Caspase3/7 activity using the respective kits from Promega Corp. ...
-
bioRxiv - Immunology 2022Quote: Cell death was monitored using CytoTox 96 Non-radioactive cytotoxicity assay (Promega). PBMCs were treated with OLT1177 ...
-
bioRxiv - Cancer Biology 2020Quote: Cell death was assessed using the CellTox Green Cytotoxicity Assay (Promega, USA) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: Luciferase reporter with minimal promoter (pGL4.23, Promega) and Renilla luciferase plasmid (pGL4.74 ...
-
bioRxiv - Microbiology 2022Quote: ... pGL3 promoter vector was from Promega (USA).