Labshake search
Citations for Promega :
251 - 300 of 3827 citations for Human Bcl2 Associated Death Promoter BAD ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... Plasmids with the ATAD1 variants under a truncated CMVd3 promoter were transfected into cells using the FuGENE HD transfection reagent (Promega), following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: OCA2 enhancer region was cloned from mouse genomic DNA into KpnI and XhoI sites of the pGL3 promoter vector (E1751, Promega). MITF proximal promoter was cloned into SacI and HindIII sites of the PGL4 promoter vector (E6651 ...
-
bioRxiv - Biophysics 2023Quote: Schneider S2R+ cells on coverslips were transfected with GFP-LKB1 variants under a ubiquitous promoter (Ubi::GFP-LKB1) using FUGENE (Promega).35 48 h after transfection ...
-
bioRxiv - Cell Biology 2024Quote: ... the promoter regions of VCL and TLN1 were amplified and inserted into the PGL3-Basic luciferase reporter vector (Promega, USA) using the ClonExpress Ultra One Step Cloning Kit (Vazyme ...
-
bioRxiv - Cell Biology 2024Quote: ... a 2456 bp DNA fragment of Ccl5 enhancer region and 1500 bp Ccl5 promoter were cloned into a pGL3-basic (purchased from Promega) vector between MluI and HindIII sites.
-
bioRxiv - Molecular Biology 2024Quote: ... The promoter activity was measured based on the production of luminescence by using the Dual-Luciferase Reporter Assay system (#E1910, Promega) and the Glomax Multi+ Detection System (Promega) ...
-
bioRxiv - Cell Biology 2023Quote: ... a 625bp fragment around the MRC2 transcriptional start site in a Firefly luciferase vector with a minimal promoter element (Promega) was used as previously described18 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Prune2 promoter-luciferase construct was generated by amplifying genomic DNA spanning the proximal promoter and the first exon of Prune2 gene (-1500/+50) and ligating into a pGL3-basic vector (Cat#: E1751, Promega). Truncation mutants were made using a QuikChange kit (Cat# ...
-
bioRxiv - Genomics 2023Quote: Promoters were amplified from mouse genomic DNA using primers listed in table S1 and cloned into pGL3-Basic (E1751, Promega) using SacI and BglII.
-
bioRxiv - Cancer Biology 2023Quote: ... the corresponding regions of the BUB3 promoter were cloned into XhoI and HindIII sites of the pGL4.13 (Promega, Madison, WI). Human genome DNA extracted from HCT116 cells using the TIANamp Genomic DNA Kit (Tiangen Biotech ...
-
bioRxiv - Genetics 2023Quote: ... carrying the non-risk or risk allele of each SNP (Supplemental Table 4) were cloned into the no-promoter firefly luciferase reporter plasmid pGL4.14 [luc2/Hygro] (Promega, #E6691) or minimal promoter firefly luciferase reporter plasmid pGL4.26 [luc2/miniP/Hygro] (Promega ...
-
bioRxiv - Molecular Biology 2023Quote: ... we used a pGL3 plasmid with the Firefly luciferase coding sequence followed by a poly-adenylation signal under the control of the SV40 promoter (Promega). The same enhancer sequences we integrated into the reporter locus were amplified by PCR from castaneus mouse strain DNA and inserted downstream of the poly-adenylation signal by Gibson assembly ...
-
bioRxiv - Molecular Biology 2022Quote: ... from the EPO gene enhancer (sequence: tcgaagccctacgtgctgtctcacacagcctgtctgacctctcgacctaccggccgttcgaagccctacgtgctgtctcacacagccttct gatctcgacctaccggccgttcgaagccctacgtgctgtctcacacagcctgtctgacctctcgacctaccggccgt) into the 5’ of the minimal TATA-box promoter in the pGL4.23 [luc2/minP] vector (Promega #E841A). A control pHRL-TK vector (Promega #E2241 ...
-
bioRxiv - Developmental Biology 2022Quote: HEK293 cells cultured on 10cm dishes were transfected with 10 μg of pLVTHM or pHAGE2 vectors under the control of an EF1α promoter and containing the wild-type or mutant versions of Oct4 or Sox2 with Fugene6 (Promega) using a low volume protocol (Steffen et al. ...
-
bioRxiv - Physiology 2022Quote: ... and 0.5 μg of reference plasmid pRL-TK carrying the Renilla luciferase gene under the control of the simian virus 40 enhancer and promoter (Promega). Lipofectamine 3000 reagent (Invitrogen ...
-
bioRxiv - Plant Biology 2022Quote: ... Each of the target site sequences was introduced into Arabidopsis U6 promoter-gRNA cassette cloned into pGEM-T Easy plasmid (Promega) using two-step overlapping PCR (Figure S1) ...
-
bioRxiv - Microbiology 2022Quote: ... was cloned by PCR amplification of viral cDNA into a pGEM vector under control of a T7 promoter using pGEM-T Easy Vector System (Promega). RNA standards were subsequently generated by in vitro transcription using the mMESSAGE mMACHINE™ T7 Transcription Kit (Invitrogen ...
-
bioRxiv - Genomics 2024Quote: ... the pRL plasmid acts as a transfection control with Renilla luciferase driven by an upstream CMV enhancer and CMV promoter (Promega). Test enhancers were cloned by either PCR of genomic DNA with primers containing NheI and XhoI restriction sites ...
-
bioRxiv - Immunology 2024Quote: ... dsFluc and dsGFP were produced from a T7 and SP6 promoters sequences containing the firefly luciferase sequence from pGL3-Basic plasmid (Promega) and GFP PCR amplification from plasmid pDSAG (Addgene #62289 ...
-
bioRxiv - Developmental Biology 2024Quote: ... a minimal promoter (5′-AGACACTAGAGGGTATATAATGGAAGCTCGACTTCCAG-3′) and 8x Gli1-binding sites (110) were cloned into the pGL3-Basic vector (Promega), in which Firefly luciferase was replaced with NanoLuc luciferase amplified from the pNLF-N [CMV/Hygro] vector (Promega ...
-
bioRxiv - Cancer Biology 2024Quote: ... was cloned upstream a SV40 minimal promoter and a luciferase reporter gene in the backbone of a PGL3 plasmid (Promega). We used lipofectamine 2000 to transfect p53-/- MEFs with 2 μg of either luciferase expression vector ...
-
bioRxiv - Cancer Biology 2024Quote: ... Each well was transfected with 500 ng pGL4.22 vector with or without H1-0 promoter expression as well as 5 ng Renilla luciferase control plasmid pGL4.73 (Promega, #E6911), and 250 ng of the respective pcDNA3.1 vectors (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the minimal promoter from the Drosophila Ac gene were cloned between KpnI and NcoI sites of pGL3-basic (Promega). Note ...
-
bioRxiv - Microbiology 2024Quote: ... and cells were transfected with 400 ng of promoter luciferase construct or cotransfected with a 1:4 ratio of promoter luciferase to expression plasmid using Fugene 6 (5:1 transfection reagent to DNA, Promega). pcDNA3.1 empty vector was used as carrier DNA during transfection ...
-
bioRxiv - Genomics 2024Quote: ... segments of the MDTH’s 3’UTR-miRNA target sites or a mutant target sequence were subclone into a pGL3 vector with SV40 promoter for transient expression of luciferase gene (Promega). We performed targeted sequencing to validate the insert and construct ...
-
bioRxiv - Biophysics 2024Quote: ... the HSP70 promoter (-775 to 214) or three repeats of the HSP70 promoter HSE (AGAACGTTCTAGAAC) were subcloned in the pGL3-Basic vector (Promega) using NheI and XhoI as restriction sites.
-
bioRxiv - Cancer Biology 2024Quote: Plasmids encoding firefly luciferase driven by an estrogen-response promoter element (gift from Dorraya El-Ashry) and CMV-Renilla luciferase (Promega) were co-transfected into cells using Lipofectamine 2000 ...
-
bioRxiv - Molecular Biology 2022Quote: ... sequence was amplified from human genomic DNAs and used as in vitro transcription template in the reaction using Riboprobe System-T7 Kit (P1440, Promega) in the presence of 0.4μL 5-(3-Aminoallyl)-uridine-5’-triphosphate labeled with ATTO 680(Aminoallyl-UTP-ATTO-680 ...
-
bioRxiv - Immunology 2024Quote: ... Supernatants were then assayed for IL-1β (human; DuoSet; R&D) and relative LDH levels (as a surrogate for pyroptosis) using a CytoTox 96 Kit (Promega). For the THP-1 LPS signaling assays ...
-
bioRxiv - Immunology 2024Quote: ... Supernatants were then transferred to a 96-well plate for storage and assayed for IL-1β (human; DuoSet; R&D) and relative LDH levels using a CytoTox 96 Kit (Promega). Once supernatants were removed ...
-
bioRxiv - Biochemistry 2024Quote: Kinase reactions were performed on the recombinant human PER2 FASP or Degron using the ADP-Glo kinase assay kit (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... ELISA plates were developed using the fluorescent ATTOPHOS substrate system (Promega, Madison WI, USA) for 15 min ...
-
bioRxiv - Plant Biology 2021Quote: ... The pSPUTK promoter allowed in vitro protein synthesis using the TnT® SP6 High-Yield Wheat Germ Protein Expression System (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... WT or ADAR1-KO HEK293T cells in 12-well plates were transfected with 400 ng ml-1 of firefly luciferase under control of the IFN-β promoter (pIFN-Luc, Promega), 40 ng ml-1 of Renilla luciferase under a constitutive promoter (pRL-TK ...
-
bioRxiv - Molecular Biology 2021Quote: ... A DNA fragment spanning the promoter and the 5′ UTR of Eef2 was PCR-amplified from mouse NIH3T3 genomic DNA and substituted for the CMV promoter of the psiCHECK2 vector (Promega, C802A). The intergenic region between Renilla and firefly luciferase in this plasmid was replaced by the sequence of HCV IRES PCR-amplified from psiCHECK2-HCV-IRES (Iwasaki et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... or −248/+91 (from −284 to +91 bp) of EPHA4 promoter region were cloned into pGL3-Basic vector (Promega, Madison, WI) to allow transcription of firefly luciferase gene under the control of this fragment ...
-
bioRxiv - Cancer Biology 2022Quote: ... MYBL2e or CCNE1e were amplified from OE19 genomic DNA using primers containing 20 bp overlap regions with the multiple cloning site of the pGL3 Promoter vector (Promega, E1761) for luciferase assays ...
-
bioRxiv - Microbiology 2020Quote: ... and pGL3-IFN-λ1-Luc (IFN-λ1 luciferase reporter) were constructed by inserting the promoter region into pGL3-Basic (Promega, USA) by standard molecular cloning methods as described in our previous publications.30-32 pISRE-Luc (the luciferase reporter of ISGs ...
-
bioRxiv - Immunology 2020Quote: ... 50 ng of an IFNβ promoter reporter plasmid (p125-luc) and 20 ng of a Renilla luciferase reporter (pRL-TK; Promega E2241) under control of a thymidine kinase promoter were co-transfected ...
-
bioRxiv - Biochemistry 2023Quote: ... U2OS PINK1 KO cells seeded at a density of 40,000 cells per 18mm glass coverslip in a 12 well plate were transiently transfected with 0.5 ug of plasmid DNA expressing WT-HA PINK1 under the control of a CMV weakened promoter using FuGene HD (Promega, E2311) at a ratio of 1:3 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 9X GAL4-binding sites and an HSV TK promoter were cloned upstream of the firefly luciferase gene in the pGL4.27 vector (Promega, Cat. E8451), yielding the luciferase reporter vector ...
-
bioRxiv - Microbiology 2022Quote: ... from Huh7 genomic DNA and inserted the promoter element upstream of the firefly luciferase open reading frame in the pGL2-Basic vector (Promega Corp.). In all cases ...
-
bioRxiv - Plant Biology 2023Quote: ... Plasmid pFL61 harbouring the construct RiSKC3-GFP under the control of the PGK promoter was purified from StellarTM bacteria using the PureYield™ Plasmid Miniprep System (Promega). The yeast transformation protocol was described by (50).
-
bioRxiv - Cell Biology 2024Quote: ... transfected with luciferase reporter constructs or containing the relevant promoter regions using FuGENE HD Transfection Reagent Complex (Promega, Madison, Wisconsin, USA). pCMV-NFIA1.1 (a kind gift from Richard Gronostajski ...
-
bioRxiv - Cell Biology 2024Quote: ... the cells were lysed in 100 μl lysis buffer and subjected to promoter activity assay using the dual luciferase reporter assay system (Promega, USA). The luciferase enzymatic activity was measured using a PE Enspire Multilabel Reader (PerkinElmer ...
-
bioRxiv - Cancer Biology 2023Quote: Two regions of FAS promoter (537bp and 332bp) were cloned into pGL3-basic vector following the manufacturer’s instruction (#E1751, Promega, Walldorf, Germany). The cloned regions (FASprom_P1 and FASprom_P2 ...
-
bioRxiv - Immunology 2023Quote: ... a total of 50.000 chicken DF-1 cells were seeded in 24 well plates and were co-transfected 24h later with a vector plasmid containing the deletion mutant and a second plasmid for the expression of Firefly under the PGK promoter (Promega, USA). 24h after transfection ...
-
bioRxiv - Molecular Biology 2022Quote: ... 250 ng of the pGL3-promoter vector (or the constructions derived from it) and 125 ng of the pCMV-β-gal plasmid (Promega) were used for transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... proteins were generated with pCS2-N-terminal 5×MYC vectors and pCS2-N-terminal 3×HA vectors described above using TnT® Coupled Reticulocyte Lysate System under the SP6 promoter (L4600, Promega) and by following manufacturer’s recommendations with few modifications ...
-
bioRxiv - Molecular Biology 2024Quote: ... GATA6e or PAX8e were amplified from OE19 genomic DNA using primers containing 20 bp overlap regions with the multiple cloning site of the pGL3 Promoter vector (Promega, E1761) for luciferase assays (Supplementary Table S4) ...