Labshake search
Citations for Promega :
451 - 500 of 3827 citations for Human Bcl2 Associated Death Promoter BAD ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... or Maxwell kit (Promega). Following RNA extraction ...
-
bioRxiv - Genetics 2023Quote: ... the GoScript Kit (Promega) was used to make cDNA and qRT-PCR performed on a BioRAD c1000 Touch thermocycler.
-
bioRxiv - Molecular Biology 2020Quote: ... African green monkey kidney (Vero) or human liver (HepG2) cells were performed via MTT assay using the CellTiter 96 Non-Radioactive Cell Proliferation (Promega) kit as previously described55 ...
-
bioRxiv - Molecular Biology 2021Quote: DRD1 Gs-mediated Gs-cAMP accumulation assays with HEK293T (ATCC CRL-11268) were performed using cells transiently expressing human DRD1 and the cAMP biosensor GloSensor-22F (Promega). Cells were seeded (20,000 cells/35 μL/well ...
-
bioRxiv - Neuroscience 2020Quote: 1μg of total RNA from the human and mouse brain specimen was reverse-transcribed using the M-MLV reverse transcriptase (Promega) for efficient synthesis of the first-strand cDNA ...
-
bioRxiv - Neuroscience 2020Quote: ... and NanoLuc fused to the amino terminal 112 amino acids of human Phosducin circularly permutated at amino acids 54/55 (Promega). The NanoLuc/Phosducin fusion portion also contains a kRAS membrane targeting sequence at the carboxy terminal end ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Microbiology 2020Quote: ... incubating and chromogenic reaction generating were similar to the ACE2 assay instead of that primary antibody binding to antigen was not required and that HRP-conjugated goat anti-human IgG antibody (Promega) would be used as the secondary antibody to detect binding of CB6 antibody to the antigens.
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were resolved in reducing and non-reducing SDS-PAGE gels and membranes were incubated overnight at 4°C with the following antibodies: rabbit polyclonal anti-human p75 intracellular domain (1:1000, Promega); mouse monoclonal anti-HA (1:2000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human NOCT (1-431) or Schistosoma japonicum GST coding sequences were inserted into pFC3F using the Flexi Cloning System (Promega). To generate NOCT Δ(2-15)-3F ...
-
bioRxiv - Physiology 2021Quote: ... Plasmid DNAs coding for hSlo1 (AAB65837 in pCI-neo) and human β1 (AAH25707) or β4 (KJ893642) were transfected into the cells with either FuGene6 (Promega) or GenJet v ...
-
bioRxiv - Biochemistry 2021Quote: ... yeast (Saccharomyces cerevisiae) cell protein extract (Cat# V7341, V7461), and human K562 cell protein extract (Cat# V6951, V6941) were purchased from Promega Inc (WI ...
-
bioRxiv - Cancer Biology 2020Quote: ... Gene expression in the tumor was analyzed by using human primers using SYBR green gene expression assays (GoTaq qPCR Master Mix, A6002, Promega).
-
bioRxiv - Immunology 2020Quote: ... pCAG-Flag or pCMV-HA-N expression vectors using standard molecular cloning methods as described in our previous publications.30–32 The IFN-β luciferase reporter plasmid pGL3-IFN-β-Luc vector was constructed in our previous study.33,34 The IFNλ1 luciferase reporter plasmid pGL3-IFNλ1-Luc was constructed by inserting the 1000-bp promoter region of human IFNλ1 (nucleotides −1000 to +1, with the translation start site set as 1) into pGL3-Basic (Promega, USA) according to methods outlined in previous studies.13,34 The ISG luciferase reporter plasmid pISRE-Luc vector was purchased from Clontech (USA) ...
-
bioRxiv - Molecular Biology 2020Quote: A putative promoter region of 600bp encompassing the TSS of the human VDACs genes was selected from GenBank and cloned into pGL3 basic vector (Promega) for transcriptional activity study ...
-
bioRxiv - Molecular Biology 2021Quote: ... the sequences containing putative NRSE motifs were amplified by PCR from the human genomic DNA and then subcloned into the pGEM-T Easy vector (Promega). To generate plasmid templates for the mutated probes ...
-
bioRxiv - Molecular Biology 2020Quote: ... we isolated the sequence-paired sites from the native mouse and human Hes1 and Hes5 genes and cloned these fragments into the promoterless pGL3-Basic vector (Promega). Our synthetic promoters ...
-
bioRxiv - Molecular Biology 2022Quote: ... we amplified FES exons 9 to 11 with intervening sequences and SH3BP2 exons 9 to 11 with intervening sequences from human genomic DNA (Promega), and cloned the products into pcDNA3.1(+ ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2023Quote: All human-derived cell lines were validated by short tandem repeat (STR) profiling using PowerPlex® 16 HS System (Promega) once a month ...
-
bioRxiv - Cell Biology 2024Quote: ... The DNA fragments were PCR-amplified with primer pairs containing a XhoI and BamHI site from human genomic DNA (Promega) and subcloned into the pCLL-NoPromoter-FLuc-CMV-RLuc-dsRed2 vector ...
-
bioRxiv - Developmental Biology 2024Quote: ... Total peptide concentration was adjusted to 0.15 µg/µL according to the absorbance at 280 nm against a Mass Spec-Compatible Human Protein Extract/Digest calibration curve (Promega), using the Thermo Nanodrop 1000 ND-1000 spectrophotometer (Thermo Fisher).
-
bioRxiv - Neuroscience 2023Quote: Nine DIV hippocampal slice cultures were randomly assigned to treatment groups with the following drugs dissolved in serum-free medium: recombinant human BDNF (250 ng/mL, Promega); BDNF + K-252a (200 nM ...
-
bioRxiv - Neuroscience 2023Quote: ... 1,200 ng of ORs tagged with the first 20 amino acids of human rhodopsin (rho-tag) at the N-terminal ends in pCI mammalian expression vector (Promega) and 30 ng eGFP were transfected using Lipofectamine 2000 (11668019 ...
-
bioRxiv - Neuroscience 2022Quote: The scATAC-seq peaks that overlapped obesity-associated SNPs were PCR amplified from human genomic DNA (see primers in Supplementary Table 2) and cloned into the pGL4.23 plasmid (Promega, E84111). The associated SNPs were then introduced into these plasmids by PCR amplification with primers containing the associated variants ...
-
bioRxiv - Biochemistry 2022Quote: ... GS-mediated GS-cAMP accumulation assays were performed with HEK293T (ATCC CRL-11268) cells transiently expressing human D1R or D5R wild-type and mutant along with the cAMP biosensor GloSensor-22F (Promega). Cells were seeded (20 000 cells/35 μL/well ...
-
bioRxiv - Molecular Biology 2023Quote: ... For ACE2 overexpression HEK293T cells were transfected for 24 h with human ACE2 (pCG1-hACE2, 200 ng DNA/well) using JetPrime (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... 1200 ng of ORs tagged with the first 20 amino acids of human rhodopsin (rho-tag) at the N-terminal ends53 in pCI (Promega) and 30 ng eGFP were transfected using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: HEK293T cells were transfected with a FLAG-tagged human DHHC20-expressing plasmid and a corresponding HA-tagged substrate-expressing plasmid using FuGENE transfection reagent (Promega) and incubated overnight ...
-
bioRxiv - Molecular Biology 2023Quote: The sequences of wild-type (WT) F8 exons and 100-250 nucleotides flanking each exon were amplified from human genomic DNA (Promega) using WT PCR primers shown in Supplemental Table 1 ...
-
bioRxiv - Genetics 2024Quote: Regulatory elements were amplified by PCR from human genomic DNA using primers listed in Supplementary Table 10 and cloned into the pGL4.23 Luciferase Reporter Vector (Promega, E8411) linearized with NheI and EcoRV (New England Biolabs ...
-
bioRxiv - Immunology 2024Quote: Pyroptotic cell death was measured by assessing LDH-release in the cell culture supernatant of human and murine macrophages using a CytoTox 96 Non-radioactive Cytotoxic Assay (Promega) following the manufacturer’s recommended procedures.
-
bioRxiv - Cancer Biology 2024Quote: ... Supernatant was harvested after 3 days of co-culture and IFNγ secretion was analyzed using the Lumit human IFNγ Immunoassay (Promega) according to the manual and T-cells were analyzed for 4-1BB expression by flow cytometry.
-
bioRxiv - Microbiology 2020Quote: NCIMB8209 DNA was isolated using a commercial kit (Wizard Genomic DNA purification kit, Promega), following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... column purification kits or Maxwell 16 LEV simplyRNA Purification Kits (Promega, Madison, WI, USA) and prepared cDNA libraries using TruSeq RNA Library Prep Kit (Illumina ...
-
bioRxiv - Zoology 2022Quote: DNA was extracted with several different kits: the Wizard Genomic DNA Purification kit (Promega), the Qiagen Blood & Tissue kit ...
-
bioRxiv - Cell Biology 2020Quote: ... Caspase3 / 7 Kit (Promega company).
-
bioRxiv - Biochemistry 2020Quote: ... CellTiter-Glo 2 kit (Promega) using manufacturer’s instructions.
-
bioRxiv - Plant Biology 2020Quote: ... A Dual Luciferase kit (Promega) was used to detect reporter activity ...
-
bioRxiv - Molecular Biology 2020Quote: ... Random Primers Kit (Promega, A2800) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... Gaussia luciferase kit from Promega was used for detecting secreted Gaussia luciferase signal as per manufacturer’s protocol.
-
bioRxiv - Immunology 2021Quote: ... the commercial AMPGlo kit (Promega) was used according to the manufacturer’s instructions.
-
bioRxiv - Synthetic Biology 2021Quote: ... chromosomal isolation kit (Promega (USA)) ...
-
bioRxiv - Plant Biology 2020Quote: ... Oligo dT kit (Promega, USA) according to the manufacturers’ instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... GoTaq®qPCR kit (Promega) was used for qPCR analysis ...
-
bioRxiv - Genomics 2021Quote: ... PureYield plasmid miniprep kits (Promega), or QIAprep Spin Miniprep kits ...
-
bioRxiv - Microbiology 2023Quote: GoTaq DNA polymerase kits (Promega) were used for PCR reactions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Core Kit (Promega, Wisconsin, USA), following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Reverse Transcription Kit (Promega, USA); IBV nucleic acid amplification fluorescence detection kit (Shanghai Furex Medical Scientific and Technological Development Co. ...
-
bioRxiv - Cell Biology 2022Quote: ... The MTT assay kit (Promega) was used according to manufacturer’s instructions ...