Labshake search
Citations for Promega :
951 - 1000 of 2480 citations for ssc mir 15a RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... PCR products were cloned into pCI-neo (Promega) downstream of the Luciferase2 gene under the control of a CMV promoter ...
-
bioRxiv - Developmental Biology 2024Quote: ... and also with PCR Master Mix (M7502, Promega), Taq polymerase (EP0402 ...
-
bioRxiv - Immunology 2023Quote: ... Promega GoTaq qRT-PCR kit (Promega, Fitchburg USA) was used according to the manufacturer’s instructions ...
-
bioRxiv - Zoology 2022Quote: ... 10 μl 5x PCR buffer (Gotaq flexi, Promega), 8 μl MgCl ...
-
bioRxiv - Zoology 2023Quote: ... 10 μl 5x PCR buffer (Gotaq flexi, Promega), 8 μl MgCl ...
-
bioRxiv - Microbiology 2023Quote: ... Diagnostic PCR was performed using GoTaq polymerase (Promega).
-
bioRxiv - Physiology 2023Quote: ... PCR amplification used GoTaq Hot Start Polymerase (Promega). PCR conditions were 95°C for 3 min ...
-
bioRxiv - Zoology 2024Quote: ... 10 μl 5x PCR buffer (Gotaq flexi, Promega), 8 μl MgCl ...
-
bioRxiv - Microbiology 2020Quote: ... Two hundred nanograms of purified RNA were reverse-transcribed using Moloney Murine Leukemia Virus Reverse Transcriptase (MMLV RT, Promega). RT was primed with oligo dT(15 ...
-
bioRxiv - Cell Biology 2021Quote: ... Viral RNA was detected using the CDC 2019-Novel Coronavirus Real-Time RT-PCR Diagnostic Panel as per Centre for Disease and Control’s optimised protocol (Integrated DNA Technologies) for use with Go-Taq 1-step RT-qPCR Master Mix (Promega). Gene expression profile and SARS-CoV-2 N subgenomic RNA expression were determined with a standard qPCR cycle (50°C for 2 minutes ...
-
bioRxiv - Pathology 2022Quote: ... G490 5 × All-In-One RT MasterMix (abm) was used for reverse transcription according to the manufacturer’s protocol (Promega). The qRT-PCR analysis was performed in 96-well plates using the BIO-RAD CFX96 detection system ...
-
bioRxiv - Immunology 2021Quote: ... Reverse transcription was performed with Moloney murine leukemia virus reverse transcriptase (MMLV-RT) according to the manufacturer’s protocol (Promega) using 200 ng of total RNA ...
-
bioRxiv - Microbiology 2023Quote: ... RNA reverse transcription and cDNA amplification was then carried out by the GoTaq 1-Step RT-qPCR System (Promega), using established primers (31) ...
-
bioRxiv - Neuroscience 2023Quote: ... for 3 hours at RT and then continued overnight with addition of 2 μg of trypsin (Promega, Cat# V5280), at 37 °C ...
-
bioRxiv - Developmental Biology 2023Quote: ... with 1 ug of RNA and RT-qPCR reactions were performed using GoTaq® qPCR Master Mix (A6002 - Promega). Analyses were carried out in the QuantStudio™ 5 Real-Time PCR System ...
-
bioRxiv - Cell Biology 2024Quote: ... reduced (6.5mM DTT, 1 hour at 60°C), alkylated (54mM Iodoacetamide, 30min, RT) and digested with 1µg of Trypsin (Promega) (96) ...
-
bioRxiv - Microbiology 2021Quote: Promoter fusions to lacZ were constructed by amplification of promoter regions from genomic DNA with the specified primers (Table S4) and ligated into pGEM-T Easy (Promega) for amplification and collection ...
-
bioRxiv - Microbiology 2021Quote: ... Standard RNA was synthesized from a partial region of the GPC gene using the forward (5’-TAATACGACTCACTATAGGGCCAACCTTTTTGCAGGAGGC-3’) and reverse (5’-AGCTTCTTCTGTGCAGGATCTTCCTGCAAGCGCTAGGAAT-3’) primers and the T7 RNA polymerase (Promega), as previously described (Pemba et al. ...
-
bioRxiv - Molecular Biology 2021Quote: Reverse transcription was performed with 1-4 µg of total RNA in a 20 µl reaction volume with 10 µM VNN-(dT)20 primer and the GoScript Reverse Transcriptase (Promega). For the semi-quantitative end-point PCRs the MyTaq Red Mix (Bioline ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Cytochrome B was amplified from the same saliva sample in which DrDV-B was detected using primers Bat 05A and Bat 04A (45) and GoTaq Green Master Mix (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The region of recombination was amplified using primers PV3-F2 (5′-CTCCAAAGTCCGCATTTACA-3′) and PV1-R2 (5′-ATCAGGTTGGTTGCTACA-3′) and Taq polymerase (Promega) with an initial denaturing at 95°C for 2 min ...
-
bioRxiv - Neuroscience 2021Quote: ... reverse mutant primer oIMR1437 5′-TCC ACC TAG CCT GCC TGT AC-3′) with 1U GoTaq polymerase (Promega, Madison, USA), 1X green GoTaq buffer ...
-
bioRxiv - Neuroscience 2021Quote: The Cyp4p1 gene was amplified from the Canton-S antennal cDNA with primers ATGATTATCTTGTGGCTGATTCTG and AATAAGTCACGTTCGCCTCAC and then ligated into pGEM-T Easy (Promega). The vector carrying the full length Cyp4p1 insert was verified by restriction digests and sequencing ...
-
bioRxiv - Molecular Biology 2021Quote: DNAseI treated total RNA from mESCs was used to synthesize complementary DNA (cDNA) using random primers (Promega Cat no. C1181), dNTP mix (LAROVA Cat no ...
-
bioRxiv - Molecular Biology 2020Quote: ... Equal amounts of RNA (1 μg) were reverse-transcribed with a mixture of oligo(dT)15 and random hexamer primers using M-MLV polymerase (Promega). RT-qPCR gene expression quantifications were performed using AceQ qPCR SYBR Green Mix (Vazyme Biotech ...
-
bioRxiv - Molecular Biology 2021Quote: ... of RNA were reverse-transcribed into single-stranded complementary cDNA using an oligo-dT primer and M-MLV Reverse Transcriptase (Promega). The single-stranded cDNA products were amplified by PCR using gene-specific sense and antisense primers (mRNA TPK1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The GAL1 promoter was amplified from yeast genomic DNA using primers 4588-1/XH5103 and ligated into pGEM-Teasy (Promega) to create pCB4554 ...
-
bioRxiv - Cell Biology 2019Quote: ... The full-length coding sequence of murine Tmem98 was amplified from a mix of murine embryonic and murine keratinocyte cDNA using forward 5’-AAAAAGCTTGCCATGGAGACTGTGGTGATCGTC-3’ and reverse 5’-TTTTGAATTCTTAAATGGCCGACTGTTCCTGCAGGAAGC-3’ primers and cloned into pSP72 (Promega) as a HindIII/EcoRI fragment ...
-
bioRxiv - Cancer Biology 2020Quote: ... the promoter regions of PTGES1 and PTGES2 were amplified (primer sequences in Appendix Table S8) and introduced into the pGL3 Enhancer vector (Promega) via SpeI and HindIII sites ...
-
bioRxiv - Genomics 2021Quote: ... Fragments containing the TSS and spanning ∼1 kb were amplified with KpnI and SacI restriction sites included in primers (Table S7) and cloned into the luciferase reporter vector pGL3-basic (Promega). Candidate enhancers within 50 kb of genes bodies were selected based on the presence of ChromHMM CREs in the re-analyzed data from human LCLs ...
-
bioRxiv - Plant Biology 2020Quote: ... PAP8 full-length open reading frame was amplified from cDNA prepared with germinating seedlings using primers as described in table SI1 and cloned in TA cloning vectors (pGem-T, Promega). Translational fusions of PAP8-GFP were obtained using XhoI BamHI fragments inserted into pEZS-NL (Carnegie institution ...
-
bioRxiv - Plant Biology 2020Quote: ... One μg of total RNA was used for first-strand cDNA synthesis with an oligo(dT) primer and M-MLV reverse transcriptase (Promega). The primer sequences are listed in Supplementary Table S1 ...
-
bioRxiv - Plant Biology 2020Quote: ... and then reverse-transcribed with a cox1 specific primer (Atcox1-1; table S1) using M-MLV (Moloney Murine Leukemia Virus) Reverse Transcriptase (RNase H minus, point mutant; Promega). The RNA template was degraded by adding 1/5 volume of 1 M NaOH to the reaction mixture and incubating at room temperature for 10 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... were made by end-labeling one primer of a complementary pair (primers listed in Table 2) using 20 μM Cy5-dCTP and Terminal deoxynucleotidyl Transferase (TdT; Promega). Complementary primers (one labeled with Cy5 and the other unlabeled ...
-
bioRxiv - Microbiology 2020Quote: A random-primers based reverse transcription of 1 μg of RNA was performed with the A3500 Reverse Transcription System Kit (Promega), followed by quantitative real-time PCR on cDNA using the FastStart Essential DNA Green Master kit (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... Reverse transcription was performed using 2μg RNA of each sample and oligo (dT)18 primers by M-MLV reverse transcriptase (Promega, 28025013). Three independent biological samples were collected and analyzed ...
-
bioRxiv - Microbiology 2020Quote: ... were made by end-labeling one primer of a complementary pair (primers listed in Table S3) using 20 μM Cy5-dCTP and Terminal deoxynucleotidyl Transferase (TdT; Promega). Complementary primers (one labeled with Cy5 and the other unlabeled ...
-
bioRxiv - Plant Biology 2020Quote: ... 1 μg of DNase treated RNA was used for cDNA synthesis by oligo-dT primers and MLV reverse transcriptase (Promega) enzyme ...
-
bioRxiv - Microbiology 2020Quote: ... Twenty nanograms of DNA were used as a model for 18 cycles of amplification of the V4 region of the 16S rRNA gene, using primers 515F and 806R (Caporaso, et al. 2012: 1621-4) and GoTaq Master Mix (Promega). PCR products were quantified with the Qschd dsDNA HS kit (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... 5 pmol of each primer (C1105 5’-GGTTCATCGACATCTCCGCG-3’ and C1106 5’-AGGTCGCTGCGCATGCCAATC-3’) and 1.25 units of GoTaq® DNA polymerase (Promega). The cycling conditions were as follows ...
-
bioRxiv - Microbiology 2022Quote: ... the HSV-1 ICP0 3’UTR was amplified from pICP0(HSV-1) using psiV1ICP0UTRf and psiV1ICP0UTRr primers and inserted into psiCHECK-2 (Promega). psiChHVICP03UTR was constructed by inserting the synthesized ChHV ICP0 3’ UTR into the same position ...
-
bioRxiv - Microbiology 2020Quote: ... containing the specific primers-probe binding sites were synthesized for NoV GII and cloned into the pGEM-T Vector (Promega) resulting in the NoV-GII plasmids ...
-
bioRxiv - Developmental Biology 2021Quote: ... Amplicons flanking the targeting site were amplified with the following primers: Inp D447N Fw GCGGTTCTTTAGCACGGTTA and Inp D447N Rev: CTCCTCATCTCCCTCCATG using GoTaq G2 polymerase (Promega). PCR protocol ...
-
bioRxiv - Microbiology 2021Quote: ... primer TTC CGC AAG TTC ACC TAC C and the reverse (3’ – 5’) primer CGG GCC GGC CAT GCT TTA CG with GoTaq Flexi DNA polymerase (Promega) and the following cycling conditions ...
-
bioRxiv - Plant Biology 2021Quote: ... Reverse transcription was performed using 2 μg of total RNA and oligo(dT)20 primers with M-MLV Reverse Transcriptase (Promega). All results shown include data from three independent experiments ...
-
bioRxiv - Physiology 2021Quote: ... purified total RNA was synthesized into cDNA:RNA hybrids with Maxima H Minus Reverse Transcriptase (Thermo) and primed using equal amounts of oligo(dT)15 primers (Promega) and random hexamers (Thermo) ...
-
bioRxiv - Microbiology 2022Quote: ... using specific primers to insert MluI/NotI restriction enzyme sites and ligated on those restriction enzyme sites into pCI-Neo (Promega). All the oligonucleotides were obtained from Microsynth AG ...
-
bioRxiv - Plant Biology 2019Quote: ... using primers extended with BamHI and SacI restriction sites (GGATCCATGGA-TCATGATGCAATTA, and GAGCTCTCATGAACAACAAGG AGCC) and was subcloned into pGemT-easy (Promega). The subcloned amplicon was digested with BamHI and SacI and ligated to the BamHI-SacI digested expression vector pET24a(+)(Novagen) ...
-
bioRxiv - Genetics 2019Quote: ... A 360 bp gene-specific region of OsLUGL amplified with primers OsLUGL-PF and OsLUGL-PR (see Supplementary Table S2) was cloned into the pGEM-T Easy vector (Promega). The linearized templates were amplified from the pGEM-T plasmid containing the gene-specific region of SLG using primers Yt7 and Ysp6 ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 4 μl of this dilution was reverse transcribed using the imProm-II system with random hexamer primers and RNasin ribonuclease inhibitor (Promega). The generated cDNA was diluted with 300 ul nuclease-free water ...