Labshake search
Citations for Promega :
751 - 800 of 2354 citations for ssc mir 15a RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... a 725bp segment of the Svep1 transcript (NM_153366.4; 746-11179) was PCR amplified (PCR Master Mix, Promega) with one pair of exon-exon boundary overlapping primers (5’ TGTGGTCCTCCAAGTCACGTA 3’ ...
-
bioRxiv - Immunology 2020Quote: ... The PCR fragment was cleaned up using the Wizard SV Gel and PCR Clean-up System (Promega). The fragment was digested with EcoRI-HF and HindIII-HF (New England Biolabs ...
-
bioRxiv - Cancer Biology 2020Quote: ... The PCR product was run on the agarose gel and purified using PCR purification kit (A1222, Promega). The Alu PCR product was cloned into using pGEM-T Easy Vector (A1380 ...
-
bioRxiv - Molecular Biology 2019Quote: ... we purified PCR amplicons using the Wizard® SV Gel and PCR Clean-Up System (Promega, USA) and sequenced purified PCR products with BigDye® Terminator v3.1 cycle sequencing kit (Applied Biosystems® ...
-
bioRxiv - Immunology 2021Quote: ... containing Proteinase K and target regions were amplified by PCR using the GoTaq G2 PCR mastermix (Promega). Correct and unique amplification of the target regions was verified by agarose gel electrophoresis before purifying PCR products using the QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... PCR products were purified using the Wizard PCR Cleanup and Gel Purification system (Promega, Fitchburg, WI, USA).
-
bioRxiv - Molecular Biology 2023Quote: ... PCR amplicons were purified using the Wizard® SV Gel and PCR Clean-Up System kits (Promega), followed by Sanger sequencing (Eurofins) ...
-
bioRxiv - Plant Biology 2024Quote: ... The second PCR products were purified using the Wizard SV Gel and PCR Clean-up System (Promega) and the Agencourt AMPure XP Kit (Beckman Coulter) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... a set of cells seeded in parallel were lysed and measured using 40 μL CellTiter-Glo luminescent cell viability reagent (Promega product code G7570) per well as per the manufacturer’s recommendation ...
-
bioRxiv - Biochemistry 2020Quote: ... The reverse transcriptase M-MLV RT as well as the T4 DNA ligase were obtained from Promega. The pGEM-T Vector kit was purchased from Promega ...
-
bioRxiv - Synthetic Biology 2019Quote: ... ligated for 3 h at room temperature (RT) or overnight at 4°C using T4 ligase (Promega), and propagated in E.coli XL 10 Gold cells (Agilent) ...
-
bioRxiv - Cancer Biology 2021Quote: ... cell plates were equilibrated to RT for one hour and CellTiter-GloTM Luminescence Cell Viability Reagent (Promega) was added to the cell suspension ...
-
bioRxiv - Neuroscience 2023Quote: ... The revers transcription (RT) reaction was performed by M-MLV reverse transcription kit (Promega, Madison, WI, USA).
-
bioRxiv - Molecular Biology 2023Quote: ... Diluted RNA was assayed for AGO2 transcript using the GoTaq 1-Step RT-qPCR System (Promega A6020) with primers CTGGCTCCAGGGGACAAG (Forward primer ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products (1.5Kb) of 16S rRNA gene were cleaned with Gel and PCR Clean-Up system (Promega, USA), and quantified by NenoDrop ...
-
bioRxiv - Developmental Biology 2021Quote: ... PCR products were purified using a Wizard SV Gel and PCR Clean-Up System (Promega, Madison, WI, USA) kit ...
-
bioRxiv - Developmental Biology 2021Quote: ... PCR products were purified using a Wizard SV Gel and PCR Clean-Up System (Promega, Madison, WI, USA) kit for Sanger sequencing.
-
bioRxiv - Microbiology 2020Quote: ... PCR products were pooled and purified with Wizard Gel and PCR Clean-up Kit (Promega, Madison, Wisconsin, USA). Purified PCR products were sequenced at Michigan State University ...
-
bioRxiv - Microbiology 2022Quote: ... After purification of the PCR product with Wizard® SV Gel and PCR Clean-Up System (Promega, UK), the arsM amplicon was sequenced at Microsynth (Balgach ...
-
bioRxiv - Cancer Biology 2022Quote: ... Wizard® SV Gel and the PCR Clean-up System were used to clean the PCR products (Promega). Next ...
-
bioRxiv - Genetics 2019Quote: ... The PCR product was purified using Wizard SV Gel and PCR Clean-Up System (Promega, Madison, WI, USA) according to manufacturer instructions.
-
bioRxiv - Plant Biology 2022Quote: ... The PCR product was cleaned using the Wizard SV Gel and PCR Clean-Up System (Promega, Madison, WI), and samples were submitted to the Roy J ...
-
bioRxiv - Cancer Biology 2023Quote: ... All PCR reactions were run using 2 µL of extracted DNA in GoTaq® PCR Master Mix (Promega) and the following cycling protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... The PCR fragment was subsequently purified using the Wizard SV Gel and PCR Clean-Up System (A9281 - Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA synthesis was subsequently performed using 1 μg total RNA and oligo-dT primers (C110A, Promega, Madison, WI). Transcript levels were assessed via real-time quantitative polymerase chain reaction (qPCR ...
-
bioRxiv - Molecular Biology 2019Quote: ... 500ng of total RNAs were reverse-transcribed using SuperScript IV reverse transcriptase (ThermoFischer Scientific) and random primers (Promega). cDNA levels were measured using real-time quantitative PCR with the Power SYBR Green PCR master mix (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: Primers were designed using the Flexi Vector primer design tool http://www.promega.com/resources/tools/flexi-vector-primer-design-tool/ and cloning was performed using Flexi cloning protocol (Promega). Briefly ...
-
bioRxiv - Genetics 2022Quote: ... The DNM1 amplification was performed with specific primers pair (DNM1_Forward 5’-GGGTCTTGTACGGAGCAGGG-3’ and DNM1_Reverse 5’-GAGTCAGATAGTAAGGGCAAGCAC-3’) using Pfu DNA polymerase (Promega). After the first amplification to select DNM1 fragment of 761 bp ...
-
bioRxiv - Bioengineering 2019Quote: ... a DNA fragment of 1191 bp was amplified using the pair of primers F_GFPseq / R_T0ter (Supplementary Table S6) with the GoTaq Flexi DNA polymerase (Promega) by colony PCR following manufacturer’s instructions ...
-
bioRxiv - Physiology 2020Quote: ... and the first-strand cDNAs were synthesized using random primers and M-MLV reverse transcriptase (Promega, Madison, WI). qPCR was done by using Roche LightCycler 480 real-time PCR system (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... cDNAs were synthesized from 2μg total RNA using oligo(dT) primers and M-MLV reverse transcriptase system (Promega). cDNA was used as template for quantitative PCR using a Bio-Rad CFX-96 real time PCR apparatus and SYBR green master mix (Dongsheng Biotech) ...
-
bioRxiv - Cell Biology 2021Quote: ... was then used to transcribe 1 µg of total RNA to cDNA using Oligo(dT)15 primers (Promega). KAPA Probe Fast qPCR Master Mix (2X ...
-
bioRxiv - Microbiology 2023Quote: ... 2 ng of each purified epicPCR product was amplified using qacE_F (0.4 μM) and AP28_short (0.4 μM) primers in GoTaq polymerase master mix (Promega, United States) under the following thermocycling conditions ...
-
bioRxiv - Plant Biology 2023Quote: ... Gene of interest was amplified using designed primers (Supplementary Table 8) and cloned into pGEMT-Easy vector (Promega). Using the DIG RNA Labelling Kit (Roche Diagnostics) ...
-
bioRxiv - Plant Biology 2023Quote: ... Transcripts of interest were amplified using designed primers (Supplementary Table 4) and cloned into pGEMT-Easy vector (Promega). Digoxigenin-labelled antisense and sense RNA probes were transcribed from T7 or SP6 promoter of pGEMT-Easy vector (Promega ...
-
bioRxiv - Plant Biology 2023Quote: ... The 16S rRNA region was amplified with the standard bacterial primers 335F and 769R with GoTaq Mastermix (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... 1 μL of each primer (10 μM) and 12.5 μL of GoTaq Green Master mix (Promega®, USA). The PCR was run in a thermocycler (BioRad ...
-
bioRxiv - Developmental Biology 2023Quote: ... The reverse transcription was performed using an oligo-dT primer and the ImRrom-II Reverse Transcription System (Promega). The ABI 7700 Sequence Detection System (PE Applied-Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR for Pax7-nGFP was performed using primer Pax7nGFP.F/ Pax7nGFP.R and GoTaq G2 Hot Start Green Master Mix (M7423, Promega) via the following program ...
-
bioRxiv - Cell Biology 2023Quote: ... Dystrophin gene editing was verified by PCR for mouse dystrophin using primers Dmd_i22-i23.F/ Dmd_i22-i23.Rand GoTaq G2 Hot Start Green Master Mix (M7423, Promega) via the following program ...
-
bioRxiv - Cell Biology 2023Quote: ... RT-PCR was performed with primers Dmd_e22-e24.F / Dmd_e22-e24.R using GoTaq G2 Hot Start Green Master Mix (M7423, Promega) via the following program ...
-
bioRxiv - Neuroscience 2024Quote: ... Specific amplicons were prepared using several primer pairs (Table 1) in combination with GoTaq© DNA Polymerase (Promega).
-
bioRxiv - Neuroscience 2019Quote: ... The PCR DNAs were gel purified (Promega Wizard SV Gel and PCR Clean-up System #A9282 ...
-
bioRxiv - Genomics 2020Quote: ... or PCR master mix (Promega, Wisconsin, USA). For ExTaq polymerase reactions ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR was performed using GoTaq Green (Promega) according to the vendor protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR was performed using GoTaq Green (Promega) according to the vendor protocol ...
-
bioRxiv - Microbiology 2022Quote: PCR clean-up system (Promega, catalog #: A9285).
-
bioRxiv - Microbiology 2019Quote: ... PCR products were digested with DpnI (Promega) to remove template plasmid ...
-
bioRxiv - Microbiology 2020Quote: ... Transformants were screened using GoTaq PCR (Promega) with universal M13F (−20 ...
-
bioRxiv - Developmental Biology 2019Quote: ... 1 GoTaq™Flexi PCR buffer (Promega) and 20 pmol of each of the following four primers ...