Labshake search
Citations for Promega :
8001 - 8050 of 8279 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: Genomic DNA of all the pOXA-48 bearing strains was isolated using the Wizard genomic DNA purification kit (Promega, WI, USA), and quantified using the QuantiFluor dsDNA system (Promega ...
-
bioRxiv - Microbiology 2021Quote: ... for 5 min while orbital shaking and using 20 μL of lysate with 20 μL of Luciferase Kit substrate (Promega, E1501).
-
bioRxiv - Cancer Biology 2020Quote: ... Plates containing the different transfected cells were incubated for 24 hours at 37°C before the luciferase activity was measured using the Dual-Glo luciferase detection kit (Promega: E2920).
-
bioRxiv - Microbiology 2022Quote: ... Screening for recombinant colonies was made by PCR as previously described [66] using the PCR conditions described above and the GoTag kit (Promega, M3001).
-
bioRxiv - Genetics 2022Quote: ... DNA was extracted from viral transport medium or directly from tracheal aspirates by Maxwell® RSC Blood DNA Kit per manufacturer’s instructions (Promega Corporation). RNase A was added to samples to remove potential viral RNA ...
-
bioRxiv - Immunology 2022Quote: ... The PCR product was extracted from 2% agarose gel and purified using the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA, USA) according to manufacturer’s instructions and quantified by Quantus™ Fluorometer (Promega, USA). Purified amplicons were pooled in equimolar amounts and paired-end sequenced on an Illumina MiSeq PE300 platform (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... Bacterial counts were obtained by comparing the signals from the tested samples with a standard curve prepared by serial dilutions of a standard sample purified using the WizardSV Gel and PCR Clean-Up System Kit (Promega, USA) and subsequently cloned into the pGEM-T vector (Promega ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.6 or 1 μg extracted RNA was converted into cDNA by reverse transcription using a High Capacity cDNA Reverse Transcription kit (Promega A3500) or a ReverTra Ace qPCR RT Master Mix (Toyobo) ...
-
bioRxiv - Pathology 2020Quote: Total mRNA was isolated from tissues using a Maxwell® LEV simply RNA Cells/Tissue kit (cat# AS1280, Promega, Madison, WI) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was extracted from samples using Maxwell® 16 automated system (Maxwell® 16 Cell DNA kits, Promega, Madison, WI, USA). Extracted DNA samples were quantified using NanoDropTM 2000 UV-Vis Spectrophotometer (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... and real-time PCR was performed on 30 ng of DNA with SYBR Green kit GoTaq® qPCR Master Mix (Promega). DNA from non-transduced cell was isolated and amplified at the same time to demonstrate the absence of contamination ...
-
bioRxiv - Synthetic Biology 2020Quote: ... we found we did not obtain clean results unless we first used a genomic miniprep kit to purify DNA (Promega Wizard). We inverted the colors for all agarose gels to assist visualization.
-
bioRxiv - Synthetic Biology 2021Quote: ... Luciferase activity was assayed in an Omega luminescence plate-reader (Fluostar) with four different gains following the instructions of the Nano Dual-Luciferase® Reporter kit (Promega). A further correction for luminescence bleed-through was applied using the software developed by Mauri et al ...
-
bioRxiv - Genomics 2021Quote: ... the strain was cultivated on PD2 medium as described (Su et al., 2016) for DNA extraction using Wizard Genomic DNA Purification Kit (A1120; Promega, USA). For Illumina sequencing ...
-
bioRxiv - Genetics 2020Quote: Yeast genomic DNA was prepared from 1 ml cultures grown in rich media from single colonies or Ade− half-sectors using the Wizard® Genomic DNA Purification Kit (Promega). Genomic DNA (150 ng ...
-
bioRxiv - Genetics 2020Quote: Molecular confirmation of HDR-mediated target site integration of the Reckh cargo was performed on genomic DNA extracted from single GFP+ black-eyed individuals using the Wizard® genomic DNA purification kit (Promega). Primers Kh1-ext-fw (CACTGTTGGCACTCCATCTG ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR product was extracted from 2% agarose gel and purified using the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA, USA) according to manufacturer’s instructions and quantified using Quantus™ Fluorometer (Promega, USA). The qualified PCR products were mixed ...
-
bioRxiv - Cancer Biology 2020Quote: To isolate RNA from cell lines we followed the manufacturer's instructions of the Maxwell 16 LEV simply RNA Kit (# AS1280) (Promega, Walldorf, Germany). Quantification of mRNA was performed using the BRYT Green® Dye (GoTaq® qPCR ...
-
bioRxiv - Genetics 2021Quote: Total RNA was extracted from cultured cells or frozen adipose tissue using the Eastep Super Total RNA Extraction Kit (Promega (Beijing) Biotech Co. ...
-
bioRxiv - Microbiology 2021Quote: ... supernatant was harvested from Calu-3 cells and inactivated by addition of lysis buffer (Maxwell 16 viral total nucleic acid purification kit, Promega #AS1150) complemented with proteinase K ...
-
bioRxiv - Microbiology 2021Quote: RNA from lysed and heat-inactivated samples was purified according to the instructions of the manufacturer using Maxwell 16 viral total nucleic acid purification kit (Promega, #AS1150) or Maxwell 16 LEV simplyRNA cell kit (Promega ...
-
bioRxiv - Cancer Biology 2021Quote: Apoptosis of cells cultured in vitro were assessed using a cleaved caspase3/7 activity kit following the manufacturer’s instructions (Promega, cat#8090). Briefly ...
-
bioRxiv - Genomics 2021Quote: ... small leaves and witches’ broom) (Figure 1B) were collected for total genomic DNA extraction using the Wizard Genomic DNA Purification Kit (A1120; Promega, USA). For Illumina sequencing ...
-
bioRxiv - Genomics 2021Quote: Genomic DNA was extracted from the aerial portions of 10-day old seedlings using the Wizard® Genomic DNA Purification Kit (Promega) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... The radioactively labeled probe was first prepared with γ[32 P]ATP ATP and DNA oligonucleotides listed in Supplementary Table S5 with a T4 polynucleotide kinase kit (Promega), purified on MicroSpin G-25 (GE Healthcare ...
-
bioRxiv - Microbiology 2023Quote: ... 3 ml overnight cultures were subjected to DNA extraction using an automated Maxwell® 16 Tissue DNA purification kit and following the manufacturer’s instructions (Promega, UK). For long-read complete genome analysis ...
-
bioRxiv - Neuroscience 2023Quote: ... equal amount of RNA (2 μg) from each sample was subjected to cDNA synthesis using reverse transcriptase Kit (Promega Corporation, USA) following standard procedures ...
-
bioRxiv - Cell Biology 2023Quote: Constitutional genomic DNA is extracted from total bone marrow at the remission and purified using magnetic beads (Maxwell® RSC Whole Blood DNA Kit, PROMEGA). Tumor genomic DNA is extracted and purified using magnetic beads (Maxwell® RSC Tissue DNA Kit ...
-
bioRxiv - Biophysics 2023Quote: ... Subsequently we ran the digested fragment on a 1% TAE agarose gel and the desired ∼14 kbp DNA fragment was isolated from an agarose gel using a gel purification kit (Promega, A9282).
-
bioRxiv - Cancer Biology 2023Quote: ... Organoids were cultured for another 5 days before proceeding with microscopy image and viability test by CellTiter-Glo 3D kit (Promega: G9681) following manufacturer’s instructions.
-
bioRxiv - Genomics 2023Quote: ... DNA desulphonation and cleanup steps were immediately performed following the manufacturer instructions of the MethylEdge® Bisulfite Conversion System kit from Promega. After the column cleanup ...
-
bioRxiv - Molecular Biology 2023Quote: ... prior to firefly and Renilla luciferase activity measurements which were performed in triplicate using the Dual-GLO kit (Promega cat. #E2920). The whole procedure was repeated three times independently for each construct.
-
bioRxiv - Cell Biology 2023Quote: ... Cells were cultured in a 6-well plate and transfected with 10 µg of linearised plasmid expressing the SV40 Large T antigen using the FuGene Transfection Kit (Promega, #E2691) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: ... from the access handles by running this on a 1% agarose gel and gel purify the right DNA fragment with a gel purification kit (Promega, A9282).
-
bioRxiv - Genomics 2023Quote: ... Resulting genomic DNA was assessed for concentration and purity using Promega DNA quantification kit on the Promega Quantus Fluorometer (Promega, Germany) and measurement of A260/A280 ratio on the MultiSkan Sky High spectrophotometer (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2024Quote: Genomic DNA was isolated from the 102 human FFPE colorectal tissue samples using the Maxwell® RSC Blood DNA Kit (Promega) on a Maxwell® 16 MDx (Promega) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 3μg RNA was used to synthesize the first strand cDNA in a 20μl reaction using the Reverse Transcription System kit (Promega, Beijing, China). The GoTaq® qPCR and RT-qPCR Systems kit (Promega ...
-
bioRxiv - Cancer Biology 2022Quote: ... Tumor DNA was extracted from parts of FFPE containing a high fraction of tumor cells using Maxwell® RSC DNA FFPE Kit (Catalog number: AS1450, Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2024Quote: Total RNA was extracted from powdered whole heart tissue samples using the SV Total RNA isolation kit (Promega, Madison, WI, USA) according to the manufacturer’s instructions or from hiPSC-cardiomyocyte extracts with the TRIzolTM reagent (Invitrogen ...
-
bioRxiv - Genomics 2023Quote: ... control Fiber-seq on dechromatinized DNA was performed on genomic DNA purified from Drosophila S2 cells using the Promega Wizard HMW DNA Extraction Kit (Promega A2920). 2 µg of DNA was used in a final volume of 60 µL in Buffer A with 0.8 mM S-adenosylmethionine and 200 U Hia5 ...
-
bioRxiv - Microbiology 2023Quote: ... We used 1 ml of cultures and isolated the genomic DNA using the Wizard Genomic DNA Purification Kit (Promega; Madison, WI). We used the DNA with the Illumina DNA Prep kit (Illumina ...
-
bioRxiv - Microbiology 2024Quote: ... Treatments did not affect bacterial or cell viability as assessed by Lactate dehydrogenase release in the culture supernatant (LDH cytotoxicity kit®, Promega, according to the manufacturer’s instructions ...
-
bioRxiv - Zoology 2024Quote: ... The amplicon target was amplified from WNV cDNA using the qPCR primers with the forward primer flanked by T7 sequence (5’-TAATACGACTCACTATAGGGATTCGGGAGGAGACGTGGTA-3’) and transcribed using T7 RiboMAX Express Large Scale RNA Production System kit (Promega, France). RNA was purified by ethanol precipitation ...
-
bioRxiv - Biochemistry 2024Quote: ... eloB and eloC) were purified on an agarose gel using the Wizard ® SV gel and PCR clean-up system purification kit (Promega). After restriction with the corresponding restriction enzymes (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: ... Nucleic Acid Purification with Proteinase K digestion was performed using Maxwell ® RSC Total Viral Nucleic Acid Purification Kit according to the manufacturer’s protocols (Promega, USA). For preparation of bacterial genomic DNA ...
-
bioRxiv - Microbiology 2023Quote: ... The amplified PCR fragments were checked for uniformity and size using 0.8% agarose gel electrophoresis and purified using a PCR fragment recovery kit (Promega, WI, USA). The recovered DNA fragments were sequenced using the MiSeq 500PE v.2 kit (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: Genomic DNA was prepared from single cell suspensions of thymic leukemias using the Wizard Genomic DNA Purification Kit (Promega, Madison WI). PCR amplification of the Jak3 pseudokinase domain was performed using MyTaq HS Red Master Mix (FroggaBio ...
-
bioRxiv - Cell Biology 2023Quote: ... Amplified ORFs were then used as templates in a PCR reaction to amplify a full-length mutant amplicon followed by their purification using Wizard SV Gel and PCR Clean-Up kit (Promega, USA). These ORFs were digested with KpnI and BamHI enzymes and ligated into similarly digested pDsRed vector ...
-
bioRxiv - Genomics 2023Quote: ... We added 200 µL of PBS to each cell pool and performed the 22 DNA extractions using the Buccal Swab protocol of the ReliaPrep™ gDNA Tissue Miniprep System kit (Promega). We adjusted the lysis time to two hours before performing the RNAse treatment ...
-
bioRxiv - Microbiology 2022Quote: Total RNA from each lung homogenate and nasal wash was isolated using the Maxwell RSC Maxwell RSC Viral Total Nucleic Acid Purification Kit (Promega Corporation), following the manufacturer’s suggested protocol ...