Labshake search
Citations for Promega :
651 - 700 of 1197 citations for Transcription Factor 15 TCF15 Antibody FITC since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... and Flag-tagged HGF WT and HGF 4Cys-4Ala were in-vitro translated (TNT quick coupled Transcription/Translation system, Promega) and were incubated with the bead bound c-MET for 4h at 4 °C ...
-
bioRxiv - Microbiology 2021Quote: ... Approximately 4 μg of the extracted material was then used as template to in vitro synthesized viral genomic RNA transcripts using the Ribomax T7 RNA transcription Kit (Promega) and Ribo m7G Cap Analogue (Promega ...
-
bioRxiv - Cell Biology 2021Quote: ... The RNA concentrations were measured and 1ug RNAs were used to synthesize cDNA using the GoScript Reverse Transcription System kit(Promega).
-
bioRxiv - Microbiology 2022Quote: The pRepDV2Rluc plasmid [37] was linearized with XbaI and used as template for in vitro transcription of replicon RNA using the T7 RiboMAX Large Scale RNA Production System (Promega) in the presence of Ribo m7G Cap Analog (Promega ...
-
bioRxiv - Cell Biology 2022Quote: The T7-AKAP12 vector or its mutants were in vitro translated using the non-radioactive TNT® Coupled Transcription/Translation system containing rabbit reticulocyte lysate (RRL) and a biotin-lysyl tRNA according to the manufacturer’s instructions (Promega, WI) to incorporate biotin label into the translated AKAP12 protein ...
-
bioRxiv - Cell Biology 2022Quote: ... and the purified templates were used to produce single stranded digoxigenin (DIG)-labelled RNA probes with the T7 (P2075) and Sp6 (P1085) transcription polymerases from Promega. Transcription was performed after manufacturer’s instructions except for the use of the DIG-labeling mixture (11277073910 ...
-
bioRxiv - Plant Biology 2021Quote: ... Reverse transcription was performed using 2 μg of total RNA and oligo(dT)20 primers with M-MLV Reverse Transcriptase (Promega). All results shown include data from three independent experiments ...
-
bioRxiv - Neuroscience 2021Quote: ... The total RNA (1-2 μg) was reverse transcribed with a GoScript™ Reverse Transcriptase cDNA reverse transcription kit according to the manufacturer’s instructions (Promega Corporation ...
-
bioRxiv - Biochemistry 2019Quote: ... in vitro translated hnRNP M protein fragments (5 μl) produced by rabbit reticulocyte lysate using TNT Quick Coupled Transcription/Translation Systems (Promega). Proteins were incubated at 4°C for 2 hours in the binding buffer above ...
-
bioRxiv - Microbiology 2019Quote: ... synthesized by in vitro transcription of a NdeI-linearized pGEM-T plasmid containing the 135bp cDNA target fragment using the T7 RiboMAX in vitro transcription kit (Promega). Negative controls (without template RNA and RNA from mock-infected cells ...
-
bioRxiv - Zoology 2019Quote: Antisense DIG-labelled RNA probes for PhOpsin1 and PhOpsin2 were made by in vitro transcription using the SP6 RNA polymerase (Promega) and the DIG RNA Labelling Mix (Roche) ...
-
bioRxiv - Molecular Biology 2020Quote: ... [10C] and [25C]sgRNAs were synthesized by in vitro transcription (IVT) using a T7 RiboMAX Express Large Scale RNA Production System (Promega) according to the manufacture’s protocol ...
-
bioRxiv - Pathology 2021Quote: ... RNA was quantified using a Qubit and 300 ng of total RNA from each time point was used to develop cDNA using the GoScriptTM Reverse Transcription System (Promega). With the use of gene specific primers SnTox5_qPCR_F and SnTox5_qPCR_R ...
-
bioRxiv - Molecular Biology 2021Quote: ... PGC-1α full-length and protein domain were translated in vitro in the T7 transcription and translation coupled reticulocyte system (Promega) supplemented with 35S-Methionine ...
-
bioRxiv - Developmental Biology 2020Quote: ... SrpB (Waltzer et al 2002) and Med1A (Immarigeon et al 2019) by in vitro transcription/translation coupled reactions using rabbit reticulocyte extracts (TnT-Promega) isoforms labeled ...
-
bioRxiv - Plant Biology 2020Quote: ... ZCCHC8B and RBM7 proteins were obtained by in vitro transcription and translation using the TNT T7 coupled wheat germ extract system (Promega) following the protocol supplied by the manufacturer ...
-
bioRxiv - Genomics 2021Quote: ... RNAs were reverse transcribed to produce cDNAs by using the GoScript™ Reverse Transcription System Kit (Promega, cat. no. A5003). The cDNAs were then used for qPCR to evaluate gene expression ...
-
bioRxiv - Cell Biology 2021Quote: ... The flowing-phase RNA lncEry-P5 was synthesized by in vitro transcription using a T7 RNA production system (Promega, P1300) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: Transcription reactions were carried out for 20 minutes at 37 °C in a reaction volume of 250 μL containing 20 μg of plasmid template in 1x transcription buffer (Promega; 40 mM Tris-HCl pH 7.9 / 6 mM MgCl2 / 10 mM spermidine / 50 mM NaCl ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 1 μg of DNase-treated total RNA was applied for cDNA synthesis using an Improm-II Reverse transcription system (A3802, Promega) according to the manufacturer’s protocol ...
-
Optimized RNA-targeting CRISPR/Cas13d technology outperforms shRNA in identifying essential circRNAsbioRxiv - Molecular Biology 2020Quote: ... labeled antisense probes were generated using T7 RNA polymerase by in vitro transcription with the RiboMAX Large Scale RNA Production System (Promega).
-
bioRxiv - Molecular Biology 2021Quote: ... followed by a DNase I treatment and a subsequent reverse transcription with oligo d[T]18 using the GoScript RT kit (Promega). One-step RT-qPCR was performed using the SYBR FAST Mix optimized for LightCycler 480 (KAPA ...
-
bioRxiv - Molecular Biology 2021Quote: ... Proteins used for EMSA experiments were synthesized in-vitro from pTNT plasmids using TNT T7 Quick Coupled Transcription/Translation System (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... CERTL destined for expression using in vitro transcription/translation system from wheat germ extract was cloned into the plasmid pF3A WG BYDV (Promega) with an N- terminal myc epitope tag ...
-
bioRxiv - Molecular Biology 2022Quote: ... sequence was amplified from human genomic DNAs and used as in vitro transcription template in the reaction using Riboprobe System-T7 Kit (P1440, Promega) in the presence of 0.4μL 5-(3-Aminoallyl)-uridine-5’-triphosphate labeled with ATTO 680(Aminoallyl-UTP-ATTO-680 ...
-
bioRxiv - Developmental Biology 2022Quote: VC-Ubx and VC-Scr were cloned in the PcDNA3 vector and produced with the TNT-T7-coupled in vitro transcription/translation system (Promega) for EMSAs ...
-
bioRxiv - Microbiology 2022Quote: ... Approximately 4 µg of the extracted material was then used as template to in vitro synthesized viral genomic RNA transcripts using the Ribomax T7 RNA transcription Kit (Promega) and Ribo m7G Cap Analogue (Promega ...
-
bioRxiv - Plant Biology 2022Quote: ... EMF2 and POT1a proteins) or a myc-tag (pGBKT7-DEST; TRB proteins) using a TNT Quick Coupled Transcription/Translation system (Promega) in 50 μl reaction volumes according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... The mRNAs were produced by in vitro transcription using the T7 RiboMAX™ Express Large Scale RNA Production System (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... in pcDNA3/V5-Dest40 vector were expressed in T7 rabbit reticulocyte lysates using TNT T7 Quick Coupled transcription/Transaltion System (Cat# TM045, Promega) following manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2023Quote: A 265 bp PHABULOSA fragment in pGEM-T-Easy was PCR amplified with M13 primers to and used for sense and antisene in vitro transcriptions with T7 and SP6 polymerases (Promega) in the presence of 1.2 μM of α-32P-UTP (10μCi/μL ...
-
bioRxiv - Plant Biology 2023Quote: ... Five micrograms of total RNA were ligated to the RNA GeneRacer oligo adapter and subjected to reverse transcription utilizing Improm-II Reverse Transcriptase kit (Promega). The cDNA was used for amplification of cleaved PYL6 fragments ...
-
bioRxiv - Molecular Biology 2023Quote: ... Purified amplicons were used as template for in-vitro transcription reaction using T7 RiboMAX™ Express RNAi System (Promega, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: Myc- and FLAG-tagged versions of the different ALOG proteins were produced using the Quick Coupled Transcription/Translation System (TnT; Promega). 25 µL of TnT reactions producing indicated proteins were mixed with Buffer 1 to reach 150 µL and rotated at 4 °C during 1 h ...
-
bioRxiv - Physiology 2023Quote: ... and reverse transcription was performed using an M-MLV reverse transcriptase with oligo-dT primers according to the manufacturer’s instructions (Promega, USA). For RT-PCR ...
-
bioRxiv - Immunology 2023Quote: The purification of total RNA and reverse transcription to synthesize cDNA were performed using a ReliaPrep RNA Cell Miniprep System (Promega) and ReverTra Ace qPCR RT Master Mix (TOYOBO ...
-
bioRxiv - Immunology 2023Quote: RNA from purified splenic CD8 T cells was reverse transcribed into cDNA using oligo-d(T) primers and M-MuLV reverse transcription (Promega). Real-time quantitative PCR was performed using SYBR DNA polymerase (Thermo Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Guides targeting 5’ and 3’ regions (see primer sequences in Supplementary File 6) of the PIP5Pase coding sequence were produced by in vitro transcription with T7 polymerase (Promega), and co-transfected with recombinant saCas9 Nuclease NLS Protein (Applied Biological Materials Inc.) ...
-
bioRxiv - Microbiology 2023Quote: ... Five µg of purified DNA template were used for T7 in vitro transcription using RiboMAX large-scale RNA production system T7 (Promega) in presence of 40 mM cap analog (Ribo m7G Cap ...
-
bioRxiv - Molecular Biology 2024Quote: ... Digoxigenin (Dig)-labeled antisense riboprobes were produced using using T7 RNA polymerase by in vitro transcription with RiboMAX Large Scale RNA Production Systems (Promega). In brief ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1 µg of RNA was then used to synthesize cDNA in a 20 µl reverse transcription reaction using 5X First Strand Buffer and MMLV-RT (Promega) with random hexamers ...
-
bioRxiv - Developmental Biology 2024Quote: ... For RT-qPCR four micrograms of the extracted RNA from each sample were reverse transcribed with gene specific primers using Goscript reverse transcription kit (Promega). Quantitative PCR was performed using Power SYBR Green (Life Technologies) ...
-
bioRxiv - Microbiology 2024Quote: In vitro transcription and translation reactions using rabbit reticulocyte lysates as previously described (29) were performed by TNT Quick Coupled Transcription/Translation System (Promega) in the presence of [35S] Met (Perkin-Elmer) ...
-
bioRxiv - Cell Biology 2021Quote: ... LgBiT antibody (N710A) and HiBiT antibody were acquired from Promega. Chicken polyclonal MAP2 (ab5392) ...
-
bioRxiv - Molecular Biology 2021Quote: ... antibodies were detected using HRP-conjugated mouse secondary antibody (Promega). UAP56/DDX39B [1:2000] (custom generated51 ...
-
bioRxiv - Molecular Biology 2021Quote: ... antibody was detected using HRP-conjugated chicken secondary antibody (Promega).
-
bioRxiv - Molecular Biology 2021Quote: ... antibodies were detected using HRP-conjugated rabbit secondary antibody (Promega). Anti-Beta Tubulin III (Tuj1 ...
-
bioRxiv - Immunology 2023Quote: ... Secondary antibodies (Promega) were incubated for 1 h at RT ...
-
bioRxiv - Cell Biology 2019Quote: ... Gel pieces were rehydrated in 10-15 µL of solution containing 20 ng/µL trypsin (Promega, Madison, WI) in 50 mM ammonium bicarbonate for 15 min ...