Labshake search
Citations for Promega :
751 - 800 of 1197 citations for Transcription Factor 15 TCF15 Antibody FITC since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: ... a 632 bp fragment of the 121-promoter [15] was amplified by PCR (Suppl. Table 1) and inserted between the BglII and HindIII sites of pGL4.10 (Promega) using NEBuilder HiFi DNA Assembly Master Mix.
-
bioRxiv - Biophysics 2021Quote: ... the C terminus of MC1R was fused with a 15-amino-acid polypeptide linker (GSSGGGGSGGGGSSG) and a LgBiT (Promega).
-
bioRxiv - Microbiology 2019Quote: ... Digestion product was cooled and transferred to a pre-chilled 15 ml tube containing 4 ml 1.1X Ligase Buffer (Promega) and 1% Triton X-100 ...
-
bioRxiv - Neuroscience 2021Quote: ... the extracted RNA was reverse-transcribed into cDNA with the oligo (dT)15 primer with GoScriptTM Reverse Transcriptase (Promega). In Fig ...
-
bioRxiv - Molecular Biology 2022Quote: ... The human Gβ1 with a C-terminal 15-amino acid polypeptide linker was followed by a HiBiT (peptide 86, Promega), and the scFv16 was modified with an N-terminal GP67 signaling peptide and a C-terminal 8× histidine tag ...
-
bioRxiv - Bioengineering 2023Quote: ... imaging was performed 10 min after intraperitoneal (i.p.) injection with 200 μL of 15 mg/mL luciferin substrate (Promega). The total flux of luminescence was calculated by gating a region of interest (ROI ...
-
bioRxiv - Developmental Biology 2023Quote: ... a minimum of 1 µg of RNA was combined with 1 µl of Oligo (dT)15 primer (Promega, C110B) and nuclease-free water to make up a total of 5 µl and incubated at 70°C and 4°C for 5 min each ...
-
bioRxiv - Developmental Biology 2023Quote: ... A minimum of 1 µg of RNA was combined with 1 µl of Oligo (dT)15 primer (Promega, C110B) and nuclease-free water to make up a total of 5 µl and incubated at 70°C and 4°C for 5 min each ...
-
bioRxiv - Microbiology 2020Quote: ... antibody with HRP-conjugated anti-mouse secondary antibody (GE Healthcare or Promega). In addition to the experimental samples ...
-
bioRxiv - Plant Biology 2020Quote: ... an immunoblot with anti-halo antibody (Anti-HaloTag® Monoclonal Antibody-Promega) was performed to confirm protein expression and binding efficiency for each TF ...
-
bioRxiv - Microbiology 2023Quote: ... Primary antibodies used are anti-HaloTag monoclonal antibody (Promega, G921A, 1:1000), and polyclonal rabbit antibodies ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 biological replicas were collected to extract the total RNA and the cDNA was synthetized using GoScript™ Reverse Transcription Mix (Promega A2790). Primer pairs used for the qPCR are listed in Table S10.
-
bioRxiv - Molecular Biology 2019Quote: ... Two micrograms of total RNA were reverse transcribed into the first strand cDNA using the ImProm-II Reverse Transcription System (A3800, Promega, Madison, USA) according to the manufacturer’s protocol and used as a template for the amplification of the full-length camel IFNε cDNA ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The RNA was treated with Promega RQ1 DNase and reverse transcribed into cDNA using the Improm-II Reverse Transcription kit (Promega; Fitchberg, WI). Steady-state transcript levels were then measured using the cDNA template in quantitative PCR (qPCR ...
-
bioRxiv - Microbiology 2019Quote: ... Reverse transcription was performed with GoScript™ reverse transcriptase mix random hexamers according to the manufacturer’s protocol (A2800; Promega AG, Dübendorf, Switzerland) using 200 ng of total RNA ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Raw PCR products were then used to generate digoxigenin-labeled RNA probes using a T7 RNA in vitro transcription kit (Promega / Life Technologies). RNA was ethanol precipitated and resuspended in water to analyze on a Nanodrop ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1-3μl aliquots were taken for reverse transcription (RT) using the Moloney murine leukemia virus RT RNase H (−) (Promega, Madison, WI, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... DNase-treated RNA was transcribed into complementary DNA (cDNA) using the ImProm-II™ reverse transcription system and oligo-dT as primer (Promega, Germany). Quantitative real-time reverse transcriptase polymerase chain reaction (qPCR ...
-
bioRxiv - Bioengineering 2022Quote: ... The linearized DNAs were used as a template for in vitro transcription with T7 RiboMAX™ Large-Scale RNA Production System (Promega, P1320) in the presence of unmodified NTPs ...
-
bioRxiv - Cell Biology 2019Quote: ... or EED that was in vitro-transcribed and translated according to the manufacturer’s procedures (TNT T7 Quick Coupled Transcription/Translation Kit; Promega, Leiden, the Netherlands) at 4°C overnight ...
-
bioRxiv - Physiology 2019Quote: ... Complementary DNA (cDNA) was synthesized from 1.2 μg RNA using random primers and the GoScript™ Reverse Transcription System (Promega, Mannheim, Germany) at 25°C for 5 min ...
-
bioRxiv - Physiology 2019Quote: An aliquot of cDNA obtained by reverse transcription was amplified in a PCR reaction with GoTaq Green Master Mix (Promega, Milan, Italy). For each pair of primers ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA was extracted from cells using 1mL/well Trizol and 1μg RNA was reverse transcribed to cDNA using an AMV reverse transcription system (Promega, Madison, WI, USA). Primers ...
-
bioRxiv - Neuroscience 2021Quote: ... PCR products from the verified plasmids were used as template to synthetize sense and anti-sense complementary RNA probes using in vitro transcription with T7 or SP6 RNA polymerase (Promega, Madison, Wisconsin). RNA probes were tagged with dinitrophenol-11-UTP (DNP ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was synthesized via reverse-transcription of 2-5 μg of RNA using M-MLV Reverse Transcriptase (200 U, Promega, Wisconsin, USA), random primers (10 ng/μl ...
-
bioRxiv - Immunology 2020Quote: ... −75 to −1 in relative to the transcription start site (TSS) of Il13 gene) and P150 (−150 to −1) were cloned into pGL3-basic luciferase vector (Promega, Madison, WI) in BglII and HindIII cloning sites ...
-
bioRxiv - Molecular Biology 2021Quote: ... Subsequent cDNA synthesis was done via reverse-transcription of 2µg of isolated RNA using M-MLV Reverse Transcriptase (Promega, Madison, WI, USA). The generated cDNA was used to analyze differences in gene expression by RT-qPCR employing iTaq Universal SYBR Green Supermix (Bio-Rad Laboratories ...
-
bioRxiv - Immunology 2021Quote: ... was verified by Sanger sequencing and used as template in T7-promoter-based in vitro transcription/translation reactions (Promega, Madison, WI: #L1170) using [S35]-methionine (PerkinELmer ...
-
bioRxiv - Molecular Biology 2022Quote: ... and L segments (GenBank accession no. KJ710423, KJ710424, KJ710425) was obtained by reverse transcription of EBIV RNA using GoScript™ Reverse Transcriptase (Promega, USA) and a pair of DNA primers complementary to the 5’ and 3’ end of the viral genomic RNAs ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA was synthesized with primers specific for each strand separately at 50 °C (Supplemental Table S1) using the ImProm-II™ Reverse Transcription System (Promega, A3800) and subjected to qPCR with primers specific for the viral N-protein (Supplemental Table S1).
-
bioRxiv - Neuroscience 2023Quote: ... 1ug of total RNA extracted from transfected SK-N-MC cells was reverse transcribed using the ImProm-II Reverse Transcription System and random hexamer primers (Promega, Madison, MI). PowerUp SYBR™ Green Master Mix (Thermo Fisher ...
-
bioRxiv - Bioengineering 2023Quote: ... We then performed first-strand cDNA synthesis from 400 ng total RNA in 20 uL reactions using Promega GoScript Reverse Transcription Kit (Promega, catalog # A5000).
-
bioRxiv - Genetics 2023Quote: ... the vector was used as a template for in vitro transcription using the T7 RiboMAX Express Large Scale RNA Production System (Promega, Cat#P1320). The synthesized sgRNAs were extracted with phenol (pH 4–5):chloroform:isoamyl alcohol (125:24:1 ...
-
bioRxiv - Immunology 2023Quote: ... Anti-HiBiT antibody (Promega) was used as a positive control for each peptide ...
-
bioRxiv - Biophysics 2023Quote: ... The secondary antibody (Promega: anti-rabbit #W4011 ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNAs from 15 wild type and 15 mutant zebrafish embryos were extracted using TRI reagent (MRC) and treated with RQ1-RNase free DNase I (Promega) and Proteinase K (Sigma ...
-
bioRxiv - Molecular Biology 2020Quote: Preserved tissue (10-15 mg) was used for nucleic acid purification by employing the Wizard genomic DNA kit (Promega, USA) and following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... Equal amounts of RNA (1 μg) were reverse-transcribed with a mixture of oligo(dT)15 and random hexamer primers using M-MLV polymerase (Promega). RT-qPCR gene expression quantifications were performed using AceQ qPCR SYBR Green Mix (Vazyme Biotech ...
-
bioRxiv - Immunology 2022Quote: ... was added and cells were lysed at room temperature for 15 min on a shaker and luciferase activity was measured with the Dual-Glo Luciferase Assay (Promega) in a Mithras LB 940 multimode microplate reader.
-
bioRxiv - Plant Biology 2021Quote: ... Halo fusion proteins were produced from 1.5 µg plasmid DNA in a 15 µL reaction using TNT SP6 High-Yield Wheat Germ Protein Expression System (Promega). Protein expression was confirmed by Western blot with Anti-HaloTag monoclonal Ab (1:2000 ...
-
bioRxiv - Microbiology 2019Quote: ... samples were digested with 1mg/ml of RNAseA for 1h at 37°C followed by 15 min inactivation at 72°C and addition of RNAseIN (Promega), or with DNase using the Turbo DNA-free kit (Ambion ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were lysed for 15 minutes on ice then treated with 10 µL of RQ1 DNase (Promega, catalog no. M610A) for 5 minutes at 37°C ...
-
bioRxiv - Plant Biology 2022Quote: ... The Halo fusion proteins were produced using 1.2 μg plasmid DNA of the respective pIX-HALO construct in a volume of 15 μl using the TNT SP6 High-Yield Wheat Germ Protein Expression System (L3260, Promega). Protein expression was confirmed by Western blot with Anti-Halo Tag monoclonal antibody (1:2000 ...
-
bioRxiv - Developmental Biology 2022Quote: ... The VEGFA probe was a 600bp fragment amplified using PCR from HH stage 15 embryo cDNA using primers CCATGAACTTTCTGCTCACTTGG and CTGCTCACCGTC-TCGGTTTTTC and cloned into pGEM-T Easy (Promega). The VEGFR2 probe was a generous gift from C ...
-
bioRxiv - Cell Biology 2019Quote: ... RT reaction was carried out in 15 ul reaction mixture at 40 °C for 60 min after addition of ImProm II (Promega). DNA fragments for L chain and the variable region of H chain (VH ...
-
bioRxiv - Molecular Biology 2020Quote: ... and rehydrated with 5 μL of digestion solution containing 20 mM ammonium bicarbonate and 15 ng/μL sequencing grade trypsin (Promega). Digestion was carried out at 37°C for 6 h ...
-
bioRxiv - Physiology 2021Quote: ... purified total RNA was synthesized into cDNA:RNA hybrids with Maxima H Minus Reverse Transcriptase (Thermo) and primed using equal amounts of oligo(dT)15 primers (Promega) and random hexamers (Thermo) ...
-
bioRxiv - Cell Biology 2019Quote: ... at pH 8 and subjected to reductive alkylation (using 15 mM iodoacetamide and 5 mM DTT) and methanol/chloroform extraction followed by digestion with sequencing-grade Trypsin (Promega) overnight at 37°C.Tryptic peptides were desalted and analyzed by liquid chromatography tandem mass spectrometry (LC-MS/MS ...
-
bioRxiv - Genetics 2020Quote: The frameshifting efficiency of the reporter plasmids in cultured cells were assayed as described previously (15, 16) using a dual luciferase reporter assay system kit (Promega). 24 hours post transfection ...
-
bioRxiv - Zoology 2021Quote: ... Polymerase chain reactions in a 15 μL solution containing 7.5 μL GoTaq® G2 Hot Start Green Master Mix (Promega), 0.4 μmol of each primer and 46 – 247 ng of genomic DNA were performed using a C1000 Touch Thermal Cylinder (BioRad) ...