Labshake search
Citations for Roche :
4451 - 4500 of 5547 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: Digoxigenin-labeled RNA antisense probes and corresponding sense probes were synthesized using DIG RNA Labelling Kit (Roche, Basel, Switzerland) and the specific primers are listed in Supplementary Table 1 ...
-
bioRxiv - Plant Biology 2024Quote: ... The RT-qPCR reaction was performed using the FastStart Essential DNA Green Master Kit (Roche Diagnostics GmbH, Mannheim, Germany) and the LightCycler 96 thermal cycler (Roche ...
-
bioRxiv - Molecular Biology 2024Quote: ... The purified DNA fragments were prepared according to the protocol of the KAPA LTP Library Preparation kit (KR0453, Roche) before sequencing ...
-
bioRxiv - Neuroscience 2024Quote: ... The genotyping of these mice was performed with a KAPA2G (15) Fast Hot Start DNA polymerase kit (KAPA Biosystems). The following primers were used to identify Pink1 WT and KO mice ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and the concentration measured by qPCR with the KAPA Library Quant Kit (Kapa Biosystems Pty, Cape Town, South Africa). Sequencing consisted of paired-end sequencing with 150 bp read length and was performed by the SNP&SEQ Technology Platform in Uppsala on a NovaSeq 6000 with a S4 flowcell and v1.5 sequencing chemistry.
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... We prepared RNA libraries using the KAPA mRNA HyperPrep Kit and Unique Dual-Indexed Adaptors (KAPA Biosystems; Massachusetts, USA), with 100 ng of RNA as input ...
-
bioRxiv - Cancer Biology 2024Quote: Total RNA was isolated from the cells using the Roche High Pure RNA isolation kit (Roche Life Science, 11828665001) and reverse transcription was performed using the iScript cDNA synthesis kit (Biorad ...
-
bioRxiv - Cancer Biology 2024Quote: Digoxogenin labeled cRNA probes were generated by in vitro transcription of 1µg template DNA with the RNA DIG labeling kit (#11175025910, Roche) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: Equal amounts of total RNA (1 µg) were reverse-transcribed using the Transcriptor First Strand cDNA Synthesis Kit (Roche) with random hexamer primers for one hour at 50°C ...
-
bioRxiv - Genetics 2024Quote: ... rRNA-depleted RNA-seq libraries were prepared using the KAPA Stranded RNA-seq Kit with RiboErase HMR (Kapa Biosystems) per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... The cDNA libraries were assessed for their quality with a Bioanalyzer and quantified using the KAPA Library Quantification Kit according to the manufacturer’s recommendations (KK4824, Roche). The libraries were then mixed in equal molar ratios and the resulting library pools underwent cluster generation using the NovaSeq 6000 System according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1μg of Hi-C library per sample was hybridized with 120bp biotinylated oligos using the SeqCap EZ kits (Roche). Following washes ...
-
bioRxiv - Developmental Biology 2024Quote: ... Semi-quantitative PCR was performed with the resulting cDNA using the LightCycler 480 SYBR Green I kit (Roche, 4707516001) and the primers listed below ...
-
bioRxiv - Plant Biology 2020Quote: ... The first-strand cDNA was synthesized from 2 μg of total RNA with an anchored-oligo (dT)18 primer using the Transcriptor High Fidelity cDNA Synthesis Kit (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... and the powder was solubilized in the native extraction buffer supplied in the kit with addition of Complete Protease Inhibitor Cocktail (Roche). After incubation on ice for 10 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... Reverse transcription was done with the first Strand synthesis kit (Fermentas) using oligo (dT)18 as a primer and qPCR was carried out with LightCycler 96 (Roche) using GAPDH.
-
bioRxiv - Cancer Biology 2021Quote: ... MCF-7 shRNA and MCF-7 shFTH1 as well as H460 shRNA and H460 shFTH1 using the High Pure RNA isolation kit (Roche) according to the manufacturer’ ss instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... was used as the template to create the Scx mRNA probe by utilizing the DIG RNA Labeling Kit Catalog #11175025910 (Roche) and the T3 RNA polymerase Catalog #11031163001 (Roche) ...
-
bioRxiv - Cell Biology 2020Quote: ... Target regions were amplified by using specific PCR primers (ETV2_F: CACTCGGGATCCGTTACTCC; ETV2_R: GTTCGGAGCAAACGGTGAGA, KDR_F: CAAGCCCTTTGTTGTACTCAATTCT; KDR_R: ATTAATTTTTCAGGGGACAGAGGGA) and KAPA HiFi HotStart PCR kit (KAPA Biosystems, Cat No. KK2601). Sanger sequencing (Genewiz ...
-
bioRxiv - Cell Biology 2020Quote: The RNA probes were transcribed with the T7 polymerase and labeled using the DIG RNA labeling kit (Roche Cat # 11175025910). After the labeling reaction was complete ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell viability was assessed by addition of 5 μl of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (i.e., MTT) using a Cell Proliferation Kit I (Roche Diagnostics, Mannheim, Germany), in accordance with the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... were performed with the Ventana Bench-Mark XT automated staining system (Ventana) using the UltraView Universal DAB Detection Kit (Roche). For α-Syn ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA probes were created from in vitro transcription of PCR products carrying the T7 RNA polymerase recognition sequence at one end and synthesized by using a digoxigenin (Dig)-labeling kit (Roche). Wing discs of L3 larvae were hybridized with probes overnight at 56 °C using standard procedures and visualized using anti-Dig-AP (1:1,000 ...
-
bioRxiv - Microbiology 2020Quote: ... Both the pET28a vector and the Rv1630 gene amplification product (1446 bp) were purified using the PCR quick spin kit (Roche) following the manufacturer’s protocol ...
-
X-linked palindromic gene families 4930567H17Rik and Mageb5 are dispensable for male mouse fertilitybioRxiv - Genetics 2021Quote: ... Final libraries were quantitated by Kapa qPCR using Kapa’s library quantification kit for Illumina sequencing platforms (Kapa Biosystems, catalog # KK4835). Pooled libraries were subjected to 150 bp paired-end sequencing according to the manufacturer’s protocol (Illumina NovaSeq6000 ...
-
bioRxiv - Genetics 2021Quote: ... For whole-genome sequencing DNA was extracted using the MagNA Pure LC Total Nucleic Acid Isolation Kit (Roche Diagnostics GmbH).
-
bioRxiv - Developmental Biology 2021Quote: ... Digxigenin (DIG)-labeled sense and antisense probes were performed from the linearized pGEM-T-easy plasmids using the DIG RNA Labeling Kit (Roche).
-
bioRxiv - Microbiology 2020Quote: ... and via real-time quantitative polymerase chain reaction (qPCR) with the KAPA Library Quantification Kit (Kapa Biosystems, Wilmington, MA, USA). Final library pools were spiked with a non-indexed PhiX control library (Illumina ...
-
bioRxiv - Developmental Biology 2021Quote: Mice ear notches or embryo tail tips were genotyped by PCR using Kapa2G Robust HotStart PCR Kit (Kapa Biosystems, KK5517) and Lbx1 primers (Table S1) ...
-
bioRxiv - Developmental Biology 2021Quote: ... The levels of relevant mRNAs were quantitated by real-time PCR using One Step SYBR GREEN RT-PCR Kit (Roche) in a Light Cycler instrument (Roche Applied Science ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Chromo-1 transcriptome sequencing was performed on the Illumina HiSeq platform (UCLA Clinical Microarray Core) with read lengths of 100 bp using the KAPA stranded RNA-seq kit (Roche) to construct paired-end libraries ...
-
bioRxiv - Neuroscience 2020Quote: ... 1ug of RNA per sample was processed using KAPA Stranded mRNA-Seq Kit with mRNA Capture Beads (Kapa Biosystems; KK8421). Library was eluted in 20µl of elution buffer ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The Illumina library construction and sequencing were performed at Duke University using KAPA Hyper Prep kits (Kapa Biosystems, Wilmington, MA) and the Illumina NovaSeq 6000 platform (paired-end 150 bp reads) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Automated dual indexed libraries were constructed with 250 ng of genomic DNA utilizing the KAPA HTP Library Kit (KAPA Biosystems) on the SciClone NGS instrument (Perkin Elmer ...
-
bioRxiv - Developmental Biology 2020Quote: ... gbx1 and pax6a digoxigenin and FITC antisense probes were generated from linearized plasmids using an RNA labelling and detection kit (Roche)87 ...
-
bioRxiv - Microbiology 2021Quote: ... 1 µg of total RNA was then reverse-transcribed to cDNA using the iScript cDNA synthesis kit (Biorad; #1708891) (Roche). Diluted cDNAs (1:5 ...
-
bioRxiv - Pathology 2022Quote: ... We used genomic DNA isolated from ear tissue with a High Pure PCR Template Preparation Kit (Roche Diagnostics, Basel, Switzerland). The transgene was detected using RT2 qPCR Primer Assays from Qiagen (Venlo ...
-
bioRxiv - Neuroscience 2022Quote: ... A total of 72 mRNA libraries for Illumina sequencing were prepared using KAPA mRNA HyperPrep Kit (KAPA Biosystems, cat. KK8581) from 250 ng of total RNA ...
-
bioRxiv - Neuroscience 2021Quote: ... and then washed in PBS buffer before incubation with terminal deoxynucleotide transferase (In Situ Cell Death Detection kit; Roche, Switzerland) for 1 h at 37 °C in a solution containing TMR red dUTP ...
-
bioRxiv - Molecular Biology 2020Quote: ... Genomic DNA was sent to the Hopkins Genetics Resource Core Facility and High Throughput Sequencing Center and libraries were prepared using a KAPA HyperPlus Kit (Roche), and sequenced using Illumina NovaSeq 2X50 paired end reads.
-
bioRxiv - Molecular Biology 2020Quote: ... Sequencing libraries were constructed from 1 ng of immunoprecipitated and input DNA using the KAPA Hyper Prep kit (KAPA Biosystems) and NEXTflex ChIP-seq barcodes (Bio Scientific).
-
bioRxiv - Molecular Biology 2021Quote: ... and detection were performed with a DIG High Prime DNA Labeling and Detection Starter Kit (Roche Applied Science, Penzberg, Germany).
-
bioRxiv - Molecular Biology 2021Quote: ... lysed with immuno-precipitation (IP)-lysis buffer (from IP Lysis kit Pierce) and supplemented with anti-protease (Roche, Basel, Switzerland). Co-immuno-precipitation (Co-IP ...
-
bioRxiv - Molecular Biology 2020Quote: ... and detection were performed with a DIG High Prime DNA Labeling and Detection Starter Kit (Roche Applied Science, Penzberg, Germany). Total RNA was isolated from frozen fungal mycelia using an RNA extraction kit (Megan ...
-
bioRxiv - Molecular Biology 2021Quote: ... the SARS-CoV-2 containing cell culture supernatant was mixed (1:1 ratio) with the Lysis Binding Buffer from the Magnapure LC Kit # 03038505001 (Roche) to inactivate the virus ...
-
bioRxiv - Genomics 2022Quote: Short-insert paired-end libraries of the lrPCR mtDNA product of the cell lines were prepared with KAPA HyperPrep kit (Roche) with some modifications ...
-
bioRxiv - Developmental Biology 2022Quote: ... samples were incubated with 27 µl labeling solution plus 3 µl enzyme solution (In Situ Cell Death Detection Kit, AP, Roche) at 37°C overnight ...
-
bioRxiv - Evolutionary Biology 2022Quote: We prepared libraries for each individual using the Kapa Hyper Prep library preparation kit (Kapa Biosystems Inc., Wilmington, MA, USA) and enzymatic fragmentation of DNA ...
-
bioRxiv - Genomics 2020Quote: ... RNA-seq libraries were generated using 300 ng of RNA with the Kapa Hyper total stranded RNA library kit for Illumina (Roche) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Entire material of one conversion was equally distributed to a 96-well plate and amplified via PCR using KAPA HiFi Uracil+ Kit (Roche) in a total volume of 16µl ...