Labshake search
Citations for Roche :
2701 - 2750 of 3367 citations for 6 hydroxy 4 6 dihydrofuro 3 2 c pyran 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... and digested for 1 hour at 37°C in 94 μg/mL DNase I (Roche) and 250 μg/mL collagenase type I and 250 μg/mL collagenase type IV (Worthington Biochemicals) ...
-
bioRxiv - Microbiology 2023Quote: ... and treated for 30 min at 37°C with 20 U/ml DNase I (Roche). Virus was pelleted through a 25% sucrose cushion ...
-
bioRxiv - Developmental Biology 2023Quote: ... reverse crosslinked by incubation overnight at 65°C in the presence of proteinase K (Roche), and cleaned by RNase A (Thermo Scientific ...
-
bioRxiv - Plant Biology 2023Quote: ... The membrane was pre-hybridized and hybridized at 50°C in DIG eazy Hyb (Roche). Two double washing steps were realized using 0.1% SDS ...
-
bioRxiv - Immunology 2023Quote: ... and digested for 1 h at 37°C in 94 µg/mL DNase I (Roche) and either 250 µg/mL Liberase DL (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1xSSC and 0.5xSSC at 55°C followed by anti-Digoxigenin antibody (Roche #11093274910, 1:500) incubation for 2 hours at room temperature ...
-
bioRxiv - Cancer Biology 2024Quote: ... Sections were deparaffinized followed by antigen retrieval in CC1 buffer (pH 9, 95°C; Roche), endogenous peroxidase blocking ...
-
bioRxiv - Immunology 2024Quote: ... and treated for 30 min at 37°C with 20 U/ml DNase I (Roche). The virions were pelleted through a 25% sucrose cushion ...
-
bioRxiv - Pathology 2024Quote: ... the DRGs are incubated at 37°C with 1 mg/mL collagenase A (10103578001, Roche) for 15 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... pH 7.5) for 15 min at 37°C and blocked with blocking solution (#11096176001, Roche) for 1 hour at 37°C ...
-
bioRxiv - Biochemistry 2024Quote: ... Proteolysis was run overnight at 37°C with 1:50 (w/w) recombinant trypsin (Roche). The peptides obtained were fractionated in a 44-min chromatographic run (Evosep One ...
-
bioRxiv - Microbiology 2022Quote: ... At the end of the cell disruption dry homogenised powder of cells were resuspended in 1 ml urea buffer (8 M urea, 50 mM Tris/HCl pH 8.0 containing one tablet of ‘cOmplete’ protease inhibitor per 25 ml, Roche, Germany; 1 mM DTT; 0.1 M PMSF) and centrifuged at 16,000 × g for 10 minutes at 4 °C ...
-
bioRxiv - Cell Biology 2019Quote: ... 3) 2hr RT incubation in blocking solution (5% Sheep Serum, 1% Roche Blocking Buffer in PBST); 4 ...
-
bioRxiv - Microbiology 2020Quote: ... the DNA library of pDJB-3 plasmid prepared by KAPA Hyper Prep Kit (Roche, Basel, Switzerland) gave a pool of 150 bp paired-end reads that are destined to be assembled into a contig by the SPAdes Genome Assembler (version 3.11.0) ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) containing 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Immunology 2020Quote: ... 5’-AGCTTGGGACAATGGTAAGG-3’ and FastStart Essential DNA Green Master on a LightCycler 96 system from Roche according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... digested with NdeI and EcoRI using a 3-way ligation reaction (Rapid DNA ligation kit, Roche). This generated the intermediate plasmid pCMV-BE2+dCas9m4 ...
-
bioRxiv - Genetics 2020Quote: ... and the 3’ part with primers 8831F2 (CTGTCAAGCCACACCAGCAACAAGTGATTC) and 8831R2 (GACAGGTACCTATCACGATTGTCGCAGCTCGGGCAGTC) by PCR with Pwo (Roche) and sequenced ...
-
bioRxiv - Microbiology 2021Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Cell Biology 2019Quote: ... 5’UTRs and 3’UTRs amplifications were performed using either Expand High Fidelity PCR System (Roche) or KAPA HiFi PCR system (KAPA Biosciences ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 μl of 10% SDS and 5 μl of 10 mg/ml Proteinase K (Roche, #31158) were added and incubated at 50 °C for 1 h ...
-
bioRxiv - Cancer Biology 2024Quote: ... The cells were resuspended and washed twice in 3 ml Red Blood Cell Lysis Buffer (Roche) to remove any visible blood cells ...
-
bioRxiv - Cell Biology 2024Quote: ... with primer set #3 (Supplementary Table 1) using KAPA High-Fidelity DNA Polymerase (KAPA Biosystems, KE2502). The forward and reverse primers contained BspEI and KpnII sites respectively ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated in digestion solution (3 mg/mL collagenase D [Roche] in DMEM/F-12 [Gibco]) for 45 min at 37 °C with intermittent vortex mixing to dislodge soft tissues ...
-
bioRxiv - Systems Biology 2023Quote: ... 500 mM NaCl and 3 mM Dithiothreitol (DTT)) supplemented with 1 mg deoxyribonuclease I (DNaseI, Roche) and protease inhibitor 4-(2-Aminoethyl ...
-
bioRxiv - Immunology 2023Quote: ... ‘reverse’ 5’-GGGTACTTGATTTCATAGACTTTA-3’) were used in a qRT-PCR on a LightCycler 480 II (Roche). The data were analysed with LightCycler® 96 SW 1.1 (Roche) ...
-
bioRxiv - Immunology 2023Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Immunology 2023Quote: ... prior to gene expression analysis by real-time quantitative PCR (LightCycler, Roche; or QuantStudio 3, ThermoFisher). Quantitect SYBR green PCR mastermix (Qiagen ...
-
bioRxiv - Plant Biology 2019Quote: ... 4% (w/v) polyvinylpyrrolidone) supplemented with 2x protease inhibitor cocktail without EDTA (#11873580001, Roche) for 1 h at 4°C in an Eppendorf ThermoMixer at 2000 rpm ...
-
bioRxiv - Neuroscience 2019Quote: ... Signals were developed using a mixture of 4-Nitro blue tetrazolium chloride (Roche, 11383213001) and BCIP 4-toluidine salt solution (Roche ...
-
bioRxiv - Genetics 2021Quote: ... followed by addition of 5 µl of 4 µg/mL DNase-free RNase (Roche). Samples were loaded onto 96-well Qiacube-HT® columns and DNA was purified using a Blood & Tissue kit (Qiagen) ...
-
bioRxiv - Neuroscience 2020Quote: ... 4% V/V glycerol and Complete Mini Protease inhibitor cocktail tablets (Roche, Basel Switzerland), 1 tablet in 10 mL) ...
-
bioRxiv - Pathology 2021Quote: ... Obex samples had 4 µl of 1000 µg/mL of proteinase K (PK, Roche) (diluted in 1x PBS and 0.5 M EDTA ...
-
bioRxiv - Molecular Biology 2022Quote: ... the mutants were extracted with PBS containing 4 mM digitonin and protease inhibitors (Roche).
-
bioRxiv - Biochemistry 2022Quote: ... 4 mM DTT and 10 % (v/v) glycerol) supplemented with: cOmplete protease inhibitor (Roche), 1 mM PMSF ...
-
bioRxiv - Biochemistry 2024Quote: ... tissues were lysed in RIPA buffer (ratio 1:4) supplemented with protease inhibitors (Roche) and protein was quantified by BCA Protein Assay Kit assay.
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA was reverse-transcribed using 2.5×10-4 U/μl hexanucleotide mix (Roche), 0.4mM deoxynucleotide mix (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and digested with digestion buffer (Gibco DMEM/F12, Fisher 11320033; 4 µg/ml Roche Collagenase/Dispase ...
-
bioRxiv - Plant Biology 2023Quote: ... before to add chemiluminescent substrate CSPD® (disodium 3-(4-methoxyspiro {1,2-dioxetane-3,2’-(5’-chloro)tricyclo [3.3.1.13,7]decan}-4-yl) phenyl phosphate) (Roche). The chemio-luminescent signal was detected by using a G-Box (Syngene).
-
bioRxiv - Developmental Biology 2024Quote: ... 4 h in 1:1500 solution of anti-digoxigenin antibody (Roche, cat no. 11333089001):blocking solution ...
-
bioRxiv - Neuroscience 2024Quote: ... Tissues were blocked in blocking buffer comprised of 4% Bovine Serum Albumin (Roche, 10735087001) and 1% Triton X-100 in 1X PBS for 30 minutes at RT ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were then treated with DNase-free RNase (Roche; 5 μg.ml-1; 37°C; 30 min) and proteinase K (250 μg.ml-1 ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 30 min at 37°C and additionally with 1 mg/ml of collagenase solution (Roche) for 12-18 hr at 37°C with agitation ...
-
bioRxiv - Immunology 2019Quote: ... skin samples were digested for 1h at 37°C using 1 U/mL Liberase TM (Roche) and 5 µg/mL DNAse I (Sigma) ...
-
bioRxiv - Developmental Biology 2019Quote: ... To increase probe permeability embryos were incubated at 21°C in 10µg/ml proteinase K (Roche) for the following durations ...
-
bioRxiv - Physiology 2019Quote: ... Then all samples were incubated with TUNEL reaction mix for 60 minutes at 37 °C (Roche). After washing ...
-
bioRxiv - Neuroscience 2020Quote: ... The resulting Hi-C library was amplified by PCR (KAPA Biosystems HiFi HotStart PCR kit, KK2502), and sequenced by Illumina 50 bp paired-end sequencing.
-
bioRxiv - Molecular Biology 2021Quote: ... embryos were washed with hybridization buffer at 55 ̊C and incubated with Western Blocking Reagent (Roche) at room temperature for one hour ...