Labshake search
Citations for Roche :
2901 - 2950 of 3367 citations for 6 hydroxy 4 6 dihydrofuro 3 2 c pyran 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: Mice were euthanized and lungs were gently homogenized in HEPES buffer containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNaseI (30 μg/ml ...
-
bioRxiv - Neuroscience 2020Quote: ... the beads were washed 3 × in washing buffer (20 mM Tris, 150 mM NaCl, 0.5 % Triton-X-100, complete protease inhibitor cocktail (Roche)) that was either substituted with 2 mM EGTA or 0.5 mM CaCl2 and 1 mM MgCl2 ...
-
bioRxiv - Neuroscience 2020Quote: ... then the beads were washed 3 × with washing buffer (20 mM Tris, 150 mM NaCl, 0.5 % Triton-X-100, complete protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Neuroscience 2020Quote: ... the beads were washed 3 × in washing buffer (20 mM Tris, 150 mM NaCl, 0.5 % Triton-X-100, complete protease inhibitor cocktail (Roche)) that was either substituted with 2 mM EGTA or 100 μM CaCl2 ...
-
bioRxiv - Genomics 2021Quote: ... we blocked the slides for 1-hr using 3% BSA/PBS with 0.1% Tween and incubated slides with 1:200 secondary antibodies (Roche) in 3% BSA/4X SSC with 0.1% Tween and BSA at room temperature for 1 hr ...
-
bioRxiv - Genomics 2021Quote: ... followed by lysing the cells on ice for 3 min in 50 μl of ATAC-seq RSB containing 0.1% NP40 (Roche), 0.1% Tween-20 (Roche) ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 mL of Tris (pH = 8.5) and 3 tablets each of the protease/phosphatase inhibitors PhosStop and Complete Mini (Roche). Tissues were then lysed in Precellys Homogenizer Bertin (program 6 x 20s pulse ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were transfected according to the manufacturer’s protocol at a µL lipofectamine: µg plasmid ratio of 3:1 (X-tremeGENE 9, Roche). After 48 hours ...
-
bioRxiv - Physiology 2023Quote: ... according to the manufacturer’s protocol and were transcribed into cDNA with the 2nd generation 5’/3’ RACE Kit (Roche) in combination with the Expand High Fidelity PCR System (Roche ...
-
bioRxiv - Plant Biology 2023Quote: ... except that 2 g of fresh weight whole seedlings were harvested for each genotype (3 biological replicates each) and 1.5 ug of anti-HA 3F10 (Roche) antibody were used for immunoprecipitation ...
-
bioRxiv - Molecular Biology 2022Quote: Dried peptides were re-dissolved in 212 µL of pyro-glu buffer (16 mM NaCl, 0.5 mM EDTA, 3 mM cysteamine and 50 μM aprotinin (Roche)) ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 mM magnesium chloride) supplemented with 1 cOmplete protease inhibitor cocktail tablet per 50 ml of lysis buffer (Roche) and mechanically disrupted in a Dounce homogenizer ...
-
bioRxiv - Molecular Biology 2024Quote: ... the “tracrRNA U6.3 promoter” fragment was amplified with left (AAGATATCCGGGTGAACTTCGN19GTTTTAGAGCTAGAAATAGC) and right (GCTATTTCTAGCTCTAAAACN19CGACGTTAAATTGAAAATAGG) sgRNA primers from pUC 3GLA U6.1/3 sgRNA using Pwo polymerase (Roche) with initial 30 sec denaturation at 94°C followed by two cycles 94°C/30 sec ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cells were then washed with PBS 3 times and lysed with RIPA buffer supplemented with protease inhibitor cocktail (Roche), 0.1% Benzonase (Millipore-Sigma) ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 µg of plasmid was used for transient transfection using X-tremeGENE™ HP DNA Transfection Reagentreagent (Roche, 6366236001) following the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2022Quote: ... two PCR reactions were performed with PCR anchor primer (included in the 2nd Generation 5’/3’ RACE Kit, Roche) and GB3 (oligo 61 ...
-
bioRxiv - Physiology 2023Quote: ... or 50 Tris-HCl pH 7.5, 1 phenylmethylsulfonyl fluoride, 3% SDS (RyR, SERCA, CaMKIIδ-C273S) and supplemented with cOmplete protease inhibitor (Roche). Lysates were then incubated on ice for 15 min and centrifuged for 15 min at 15000 rcf at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... pellets were resuspended in 100 μl of lysis buffer (50 mM Tris, pH 7.5, 1 mM EDTA, 3 mM DTT, and 1X cOmplete protease inhibitor cocktail [11836145001, Roche]) and lysed on a beadbeater for 5 min at room temperature with 100 μl of acid-washed glass beads ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were first mechanically dissociated with a scalpel into approximately 1-3 mm pieces and enzymatically digested in RPMI-1640 medium (Cytiva) containing 0.25 mg/ml DNase I (Roche) and 0.25 mg/ml Collagenase (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... tissue sections (3-5μm) from frontal cortex (BA 8/9) using the Nexes station automated system (Ventana Medical System Inc., Roche). Deparaffinised and rehydrated sections were pretreated and blocked ...
-
bioRxiv - Cancer Biology 2024Quote: ... nuclei were isolated from 5 million cells with hypotonic buffer (20 mM Tris-HCl pH 7.4, 10 mM NaCl, 3 mM MgCl2, protease inhibitors (Roche)) for 15 min on ice ...
-
bioRxiv - Neuroscience 2020Quote: ... cells were fixed with 4%PFA and 100 μl of Annexin-V-Alexa 568 labeling solution (Roche) and 50 μM Sytox Green dye (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... and incubated for 15 minutes with 4 μL of X-treme Gene HP DNA transfection reagent (Roche). Transfected cells were selected for by hygromycin resistance ...
-
bioRxiv - Microbiology 2021Quote: ... 16S variable region 4 (V4) amplifications were carried out using the KAPA2G Robust HotStart ReadyMix (KAPA Biosystems) and barcoded primers 515F and 806R50 ...
-
bioRxiv - Biophysics 2021Quote: ... liposomes (final lipid concentration = 1 mM) were blocked with 4% (w/v) fatty-acid-free BSA (Roche) in HK buffer for one hour at 25°C ...
-
bioRxiv - Pathology 2021Quote: ... Then hearts were perfused and digested with perfusion buffer plus 0.067 mg/ml Liberase Blendzyme 4 (Roche) for 30min ...
-
bioRxiv - Biochemistry 2021Quote: ... The pellet was washed 4 times in PBS containing cOmplete™ EDTA-free Protease Inhibitor Cocktail (Roche). Protein samples were mixed with 4X LDS buffer containing DTT (NuPAGE™ Thermofisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 µg of genomic DNA in total was amplified by using Kapa HiFi HotStart ReadyMix (Roche KK2602). For external PCR step ...
-
bioRxiv - Cancer Biology 2024Quote: ... Isolated hepatocytes were seeded at a density of 4-500,000 and 1,000,000 cells in rat tail collagen I (5 μg/cm2, Roche) pre-coated 6-well plates and T25 flasks ...
-
bioRxiv - Pathology 2023Quote: ... After addition of 4% sodium phosphotungstic acid in 170 mM MgCl2 and protease inhibitors (Complete-TM, Roche), extracts were incubated at 37 °C for 30 minutes and centrifuged at 18,000 x g for 30 minutes at 25 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... + 4% fetal bovine serum (FBS, Hyclone) and 0.01 mg/mL insulin-transferrin-sodium-selenite solution (ITSS; Roche) as previously described 28,29 ...
-
bioRxiv - Cell Biology 2023Quote: ... and 4 g of tissue were digested by dispase/collagenase (Collagenase: 0.1U/mL, Dispase: 0.8U/mL, Roche) for 1 hour at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... 1ml of CDP-Star® Chemiluminescent Substrate (Disodium 2-chloro-5-(4-methoxyspiro[1,2-dioxetane-3,2′-(5-chlorotricyclo[3.3.1.13.7]decan])-4-yl]-1-phenyl phosphate) (Roche, Cat No. 11685627001) was added to 9ml of DIG-detection buffer and membranes were then incubated with the substrate for 5 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... IHC single- and multiplex-staining were performed on 4 µm sections using the Discovery ULTRA stainer (Roche). Antibodies and dilutions are provided in Supplementary Table 1 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Wing discs of L3 larvae were hybridized with probes overnight at 56 °C using standard procedures and visualized using anti-Dig-AP (1:1,000; Roche). Primers used for generating PCR templates are listed in Key Resources Table.
-
bioRxiv - Developmental Biology 2021Quote: ... Antisense DigoxigeninUTP-labeled RNA probes were synthesized at 37°C using RNA DIG labeling mix per manufacturer’s instructions (Roche) using RNA polymerase ...
-
bioRxiv - Developmental Biology 2021Quote: ... Skin was cut into 1mm sized pieces and digested for 45 minutes at 37°C by 0.25 mg of Liberase DL (Roche) per mL of EHAA media and DNAse (Worthington) ...
-
bioRxiv - Developmental Biology 2020Quote: ... they were hybridized overnight at 65°C for three nights and incubated overnight with 1/2,000 alkaline-phosphatase conjugated with anti-DIG Fab fragment (Roche) at 4°C for three nights ...
-
bioRxiv - Developmental Biology 2021Quote: ... treatment for 1 hour at 37°C and cDNAs were amplified with KAPA HiFi Hotstart Ready Mix (Roche, KK2602). PCR reactions were conducted as follow ...
-
bioRxiv - Developmental Biology 2022Quote: ... fins were incubated for 20 min at 28°C with vigorous shaking in a solution of Liberase DH Research Grade (0,05mg/ml in 1x PBS, Roche). Cell suspensions were passed through a 30 μm filter (CellTricks ...
-
bioRxiv - Molecular Biology 2021Quote: ... washed with cold PBS and lysed for 20 minutes at 4°C in lysis buffer (10mM Tris pH 8, 10mM NaCl, 0.2% NP-40, supplemented with cOmplete proteinase inhibitors (Roche)) prior to snap freezing in 1ml lysis buffer on dry ice ...
-
bioRxiv - Epidemiology 2019Quote: ... and C-reactive protein (CRP) was measured by automated particle-enhanced immunoturbidimetric assay (Roche UK, Welwyn Garden City, UK). CRP levels were measured at nine ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were harvested 4 hours after induction at 37°C and lysed by sonication in 1x PBS pH 7.5 with 1 tablet protease inhibitor cocktail (Roche). After cell lysis and centrifugation at 30,000g ...
-
bioRxiv - Cancer Biology 2020Quote: Tumors were mechanically dissociated and digested for 45 min at 37 °C in RPMI 1640 with 37.5 µg/mL Liberase TM (Roche) and 8,000 U/mL DNase I ...
-
bioRxiv - Cell Biology 2021Quote: ... then 10-15 ml of pre-warmed to 37 °C enzyme buffer solution (EBS) containing 0.4 mg/ml Protease (Roche) and then with 15-20 ml of 37 °C EBS containing collagenase D (0.1 U/ml ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μg poly[d(I-C)] and 0.1 μg poly-Lysine (based on DIG Gel Shift Kit, 2nd Generation, Roche) for 15 min at RT ...
-
bioRxiv - Microbiology 2021Quote: ... C-reactive protein and D-dimer levels were measured using Cobas Integra 400 plus analyzer (Roche Diagnostics Nederland B.V.).
-
bioRxiv - Immunology 2021Quote: ... ankle joints were teased apart and shaken at 110 rpm at 37°C for 25 minutes with 2.68mg/mL collagenase D (Roche) in RPMI 1640 (Gibco ...
-
bioRxiv - Cell Biology 2020Quote: ... Membranes were immunoblotted for 1 hr at 22°C using the following antibodies: rat anti-HA (1:3000; Roche), mouse anti-V5 (1:5000 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 µg of pcDNA 3.1(-) empty vector or C/EBPβ deletion mutants in 100 mm dishes using X-tremeGENE HP (Roche) according to manufacturer’s instructions ...