Labshake search
Citations for Roche :
2251 - 2300 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... 1x Roche cOmplete™ Protease Inhibitor Cocktail (#4693116001, Roche), 50 mM NaF and 1 mM sodium orthovanadate ...
-
bioRxiv - Genetics 2024Quote: ... equipment using a KAPA Library Quantification kit (KAPA Biosystems, cat. KK4824), and the fragments’ profiles were inspected using the Agilent DNA 1000 Kit on a 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Cancer Biology 2024Quote: ... qPCR for COLCA2 (OCA-T2) was performed using the LightCycler 480 (Roche) with the LightCycler 480 Probes Master Kit (Roche ...
-
bioRxiv - Developmental Biology 2024Quote: ... with the following modifications: 1 x PhosSTOP (Roche, 4906845001) was included in all solutions up to and including the primary antibody incubation ...
-
bioRxiv - Cancer Biology 2024Quote: ... following manufacturer’s instructions and captured with KAPA HyperExome following manufacturer’s instructions (KAPA HyperCap workflow v3, Roche). Sequencing of paired tumor and normal libraries was performed on Illumina HiSeqX or NovaSeq6000 (Illumina ...
-
bioRxiv - Cell Biology 2024Quote: ... supplemented with a complete protease inhibitor cocktail (Roche). Then ...
-
bioRxiv - Cell Biology 2024Quote: ... If the cells were fixed with 4% (v/v) paraformaldehyde solution and 0.1% (v/v) glutaraldehyde in vPBS containing EDTA-free protease inhibitor (Roche), the coverslips were directly mounted on glass slides after cell attachment ...
-
bioRxiv - Cell Biology 2024Quote: ... 23 mL elution were taken into 50 mL enrichment PCR reaction (13 Kappa HIFI [Roche] ...
-
bioRxiv - Cell Biology 2024Quote: ... The cells were pelleted by centrifugation (750 x g, 2 min, 4 °C) and resuspended in 50 μl vPBS containing EDTA-free protease inhibitor (Roche). The cells were fixed by addition of 0.5 ml ice-cold fixation solution (4% (v/v ...
-
bioRxiv - Cell Biology 2024Quote: ... The cytoskeletal pellet was resuspended in 1 ml vPBS containing EDTA-free protease inhibitors (Roche) and centrifuged again (3,400 x g ...
-
bioRxiv - Cell Biology 2024Quote: ... supplemented with fresh 0,51mM DTT and 1× protease inhibitor mixture Complete (Roche)) ...
-
bioRxiv - Cell Biology 2024Quote: ... Nuclear pellet was then resuspended in RIPA buffer (1X PBS, 1% NP40, 0.5% Na-deoxycholate, 0.1% SDS, supplemented with 1× protease inhibitor mixture Complete (Roche)) and chromatin was sheared to a range of 200-500bp by using a Bioruptor instrument (Diagenode ...
-
bioRxiv - Systems Biology 2024Quote: ... The resulting products were then subjected to size selection with Kappa Pure Beads (Roche) at specific ratios of 0.7× and 0.6× ...
-
Targeted Perturb-seq Reveals EGR1 and FOS as Key Regulators of the Transcriptional RAF-MAPK ResponsebioRxiv - Systems Biology 2024Quote: ... for PCRs KAPA HiFi HS RM (Roche) and different primer sets spanning regions out and/or inside expected deletions were used ...
-
Targeted Perturb-seq Reveals EGR1 and FOS as Key Regulators of the Transcriptional RAF-MAPK ResponsebioRxiv - Systems Biology 2024Quote: ... Upon quantification with Universal KAPA Library Quantification Kit for Illumina (Roche) Libraries were pooled and sent for sequencing.
-
bioRxiv - Systems Biology 2024Quote: ... qPCR was performed using the Light Cycler 480 SYBR green I Master kit (Roche, Cat# 04887352001). The primers used for RT-qPCR are listed in the Key Resource Table ...
-
bioRxiv - Systems Biology 2024Quote: ... 2.2 % (wt/vol) SDS) supplemented with complete™ EDTA-free (Roche Diagnostics, Mannheim, GER) as protease inhibitor ...
-
bioRxiv - Systems Biology 2024Quote: ... LDH released in the supernatant was detected using a cytotoxicity detection kit (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2024Quote: The qPCR reactions underwent purification using SPRI size selection with Kapa Pure Beads (Roche) at specific ratios of 0.8× and 0.7× to eliminate fragments smaller than 300bp ...
-
bioRxiv - Systems Biology 2024Quote: ... with protease and phosphatase inhibitors (Roche). Protein concentration was determined with a micro-BCA assay (Pierce) ...
-
bioRxiv - Systems Biology 2024Quote: ... The lungs were perfused through the pulmonary artery and inflated via the airway with DMEM containing 1 mg/ml Collagenase/Dispase (Roche), 3 U/ml Elastase (Worthington) ...
-
bioRxiv - Systems Biology 2024Quote: ... The library was amplified for 9 cycles with Kapa polymerase (Roche) using the oligonucleotides 5’ tagtggtagaaccaccgcttgtc and 5’ actttttcaagttgataacggactagcc and assembled into pCRISPRpp linearized by BbvCI digestion ...
-
bioRxiv - Microbiology 2024Quote: ... The probes were produced by NimbleGen SeqCap EZ (Roche NimbleGen, Inc., Madison, USA), with biotin labelling to enable retrieval of the hybridized targets using streptavidin coated magnetic beads (Kushwaha et al. ...
-
bioRxiv - Microbiology 2024Quote: ... and purified with the High Pure PCR product purification kit (Roche). Sequencing indexes were added by LGC ...
-
bioRxiv - Systems Biology 2024Quote: We amplified the cDNA using 2× Kapa HiFi HotStart ReadyMix (Roche), a high-fidelity polymerase enzyme ...
-
bioRxiv - Systems Biology 2024Quote: ... the lysis buffer was supplemented with the cOmplete protease inhibitor cocktail (Roche). The cell suspension underwent sonication through 5 cycles at 40% power for 4 pulses each ...
-
bioRxiv - Synthetic Biology 2024Quote: ... PCR amplification of cut site regions was performed with KAPA HiFi polymerase (Kapa Biosystems) according to the manufacturer-provided protocol ...
-
bioRxiv - Systems Biology 2024Quote: ... The treated lymphoma cells were cooled down by addition of the three-fold volume of ice-cold DPBS supplemented with 1xPhosSTOP (Roche) and 100µM sodium orthovanadate ...
-
bioRxiv - Systems Biology 2024Quote: ... HA (Roche, 11867423001, 1:1000 dilution); IKK2 (Cell Signaling Technology ...
-
bioRxiv - Systems Biology 2024Quote: ... and proteases (cOmplete Mini Roche, Basel, CH) and protein was isolated using RIPA buffer.
-
bioRxiv - Immunology 2024Quote: ... cOmplete protease inhibitor (1 tablet / 10 ml) (Roche, 11697498001). Protein lysates were resolved on a NuPAGE™ 4 to 12% ...
-
bioRxiv - Systems Biology 2024Quote: ... Cells were harvested using corresponding inhibitors of phosphatases (PhosSTOP Roche, Basel, CH) and proteases (cOmplete Mini Roche ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.1% NP40) supplemented with 1xprotease inhibitor cocktail (Roche, Indianapolis, USA) and 0.4 U/μl RNase inhibitor (Invitrogen ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... EDTA-free protease inhibitor cocktail (Roche, Bazel, Switzerland). The lysate was clarified by centrifugation at 15,000 g for 1 hour at 4 °C ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... EDTA-free protease inhibitor cocktail (Roche, Basel, Switzerland). The protein lysates were centrifuged (12000 g ...
-
bioRxiv - Physiology 2024Quote: Protein cardiac extracts were obtained by tissue homogenization with ceramic beads (MagNa Lyser Green Beads, Roche) in lysis buffer (50 mM Tris-HCl ...
-
bioRxiv - Physiology 2024Quote: ... digested with DNase I (Roche Diagnostics, Basel, Switzerland), and reverse transcribed with ReverTra Ace qPCR RT Kit (Toyobo ...
-
bioRxiv - Physiology 2024Quote: ... the samples were blocked with 5% skim milk in PBS-DEPC for 1 hour at 4°C and incubated with anti-DIG antibody (Roche Diagnostics) diluted 1:10,000 in the blocking buffer for 1 hour at 4°C ...
-
bioRxiv - Physiology 2024Quote: ... The purified cDNA fragments were transcribed in vitro using T7 or SP6 RNA polymerase (Roche Diagnostics) in the presence of digoxigenin (DIG)-UTP ...
-
bioRxiv - Neuroscience 2024Quote: ... co-cultures were treated every 48 h from the start of co-culture with either 1 µM LGMN inhibitor (Roche) or a DMSO control for three weeks.
-
bioRxiv - Synthetic Biology 2024Quote: 2 mg of the isolated RNA was digested with DNAse I (Roche) and cDNA was synthesized using the GoScript reverse transcription kit A5001 (Promega) ...
-
bioRxiv - Neuroscience 2024Quote: ... Supernatants were supplemented with a protease inhibitor cocktail (Complete ultra, Roche, Sigma-Aldrich) and stored at −80°C ...
-
bioRxiv - Neuroscience 2024Quote: ... for all qPCRs except C9orf72 variant 2 expression levels for which TaqMan probes were used (sequences provided in Table S2) and measured with a LightCyclerTM (Roche). qPCR was performed in technical triplicate with data normalised to GAPDH expression levels.
-
bioRxiv - Neuroscience 2024Quote: ... After rebuffering in lactose AAV titers were determined by real-time PCS on vector genomes using the SYBR Green Master Mix (Roche Molecular Systems).
-
bioRxiv - Molecular Biology 2024Quote: ... 0.5 % NP40, 2.5 mM EDTA, 0.05 % NaDeoxycholate, 20 mM Tris-HCl pH 8, 1x of PhosSTOP, 1x Roche protease inhibitor mixture), and the TE buffer (same as for histones plus 1x PhosSTOP) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Nuclear pellets were suspended in RIPA buffer (50 mM Tris-HCl, 150 mM NaCl, 1% Nonidet P-40, 0.5% NaDeoxycholate, 0.1% SDS, 1x Roche protease inhibitor mixture) and sonicated 5 times x 5 min (30 s ON/ 30 s OFF ...
-
bioRxiv - Molecular Biology 2024Quote: Beads were then washed twice with Low Salt Wash Buffer (150 mM NaCl, 0.1 % SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl pH 8, 1x Roche protease inhibitor mixture), twice with High Salt Wash Buffer (500 mM NaCl ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.44 M sucrose, 1.25 % Ficoll, 2.5% Dextran, 10 mM MgCl2, 0.5% Triton X-100, 5 mM DTT, 1x Roche protease inhibitor mixture), filtered through two layers of Miracloth ...
-
bioRxiv - Molecular Biology 2024Quote: ... and twice with TE wash buffer (10 mM Tris-HCl pH 8, 1 mM EDTA, 1x Roche protease inhibitor mixture).
-
bioRxiv - Molecular Biology 2024Quote: ... Nuclear pellet was suspended in 1 mL of TAP buffer (100 mM NaCl, 20 mM Tris-HCl pH 8, 2.5 mM EDTA, 10 % glycerol, 1 % Triton, 1x of PhosSTOP, 1x Roche protease inhibitor mixture) and given 20 strokes with the Dounce Homogenizer ...