Labshake search
Citations for Roche :
2301 - 2350 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... treated with Proteinase K (Roche) for 1 h at 45°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then dephosphorylated using the alkaline phosphatase rAPid (Roche). A target-specific gRNA was designed using CRIPR-P 2.0 (http://crispr.hzau.edu.cn/CRISPR2) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... prepared for sequencing using a KAPA HyperPrep kit (Roche) and sequenced on an Illumina MiSeq system ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and Kapa Hifi HotStart Ready mastermix (Roche) was used for the PCR reactions with the following primer sets (Supplementary Table 14) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... was amplified using F3 and R3 primers (Supp. Table 2) and KAPA-Hifi polymerase (Roche). Following a 1X SPRIselect bead DNA cleanup (Beckman Coulter) ...
-
Dysregulated expanded endocannabinoid system as therapeutic targets of amyotrophic lateral sclerosisbioRxiv - Neuroscience 2024Quote: ... The libraries were quantified using KAPA Library Quantification kits for Illumina Sequencing platforms according to the qPCR Quantification Protocol Guide (KAPA BIOSYSTEMS) and qualified using the TapeStation D1000 ScreenTape (Agilent Technologies) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... using a KAPA HyperPrep PCR-Free kit (Roche, Basel Switzerland) according to the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2024Quote: ... 0.5mM EDTA supplemented with Proteinase Inhibitor (Roche) and protein concentration was determined photometrically using the Protein Assay Dye Reagent Concentrate (BioRad) ...
-
bioRxiv - Systems Biology 2024Quote: ... iPCR amplification was carried out with KAPA HiFi HotStart ReadyMix (Roche), and a specific primer pair (AATGATACGGCGACCACCGAGATCTACACGAGCCAGAACCAGAAGGAACTTGA*C ...
-
bioRxiv - Systems Biology 2024Quote: ... Single cell clones were afterwards transduced with a retroviral vector for the expression of pMSCV_hygro_CreERT2 and selected with 250 µg/ml Hygromycin (Roche) followed by single cell clone selection.
-
bioRxiv - Systems Biology 2024Quote: ... washed with 1xPBS and lysed in 100 µl RIPA buffer containing protease inhibitor (Roche) and Benzonase (Sigma Aldrich) ...
-
bioRxiv - Systems Biology 2024Quote: ... 5 mM EDTA and 0.5% Triton X-100 containing cOmplete Mini protease inhibitor (Roche) via 3 rounds of probe ultrasonication ...
-
bioRxiv - Systems Biology 2024Quote: ... then 5 min at 62°C) with KAPA HiFi HotStart Ready Mix (Roche). Libraries were quantified by Bioanalyzer (Agilent ...
-
bioRxiv - Systems Biology 2024Quote: ... strand-specific RNA-seq library was built with the KAPA RNA Hyper Prep kit (Kapa Biosystems) following manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2024Quote: ... and 100 µL of RIPA buffer with 1 µL of 100x protease inhibitor cocktail (Roche) was added before homogenization using 400 µm LoBind silica beads (0.3-0.4 mg ...
-
bioRxiv - Systems Biology 2024Quote: ... Shotgun metagenomic sequencing libraries were prepared using a miniaturized version of the Kapa HyperPlus Illumina-compatible library prep kit (Kapa Biosystems). DNA extracts were normalized to 5 ng total input per sample using an Echo 550 acoustic liquid handling robot (Labcyte Inc) ...
-
bioRxiv - Neuroscience 2024Quote: ... proteins were extracted by resuspending cells from 6-well plates in 100 μl of RIPA or 7M Urea Buffer containing protease inhibitor (11873580001, Roche) and ...
-
bioRxiv - Neuroscience 2024Quote: ... phosphatase inhibitor (04906837001, Roche). Cell lysates were centrifuged at >14 000 x g for 15 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.1 % SDS) supplemented with cOmplete™ EDTA-free Protease Inhibitors (11836170001; Roche). 30 µl of protein A or G paramagnetic beads (73778S or 9006S ...
-
bioRxiv - Neuroscience 2024Quote: ... SYBR Green (PB20.11-05, PCR Biosystems) was used on a real-time thermal cycler (LightCycler® 480, Roche). S16 or HPRT were used as internal control gene ...
-
bioRxiv - Synthetic Biology 2024Quote: ... qPCR reactions were carried out on LightCycler 480 II (Roche). Quantification of RNA expression was normalized to ACTB (unless otherwise specified ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Colony PCR is performed using Kapa Robust (Roche) using a single colony diluted in 100μL of dH2O ...
-
bioRxiv - Synthetic Biology 2024Quote: ... These barcode primers were combined separately with another constant primer to create short double-stranded fragments containing the barcode flanked by BsaI cut sites in a single cycle of PCR using Kapa HiFi (Roche). 1μL of this reaction was added into a second Kapa HiFi (Roche ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and Kapa HiFi mix (Roche) for 14 cycles ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1μL of this reaction was added into a second Kapa HiFi (Roche) reaction with additional primers to increase the length of the amplicon over 18 cycles ...
-
bioRxiv - Neuroscience 2024Quote: ... Fluorescence signal was detected with FITC fluorophore (07259212001, Roche Diagnostics). Sequentially ...
-
bioRxiv - Neuroscience 2024Quote: ... and anti-HQ HRP (Roche; Cat#760-4820). IHC signal was detected using the Discovery Chromomap DAB kit (Cat# ...
-
bioRxiv - Neuroscience 2024Quote: ... Each resulting denatured protein sample was chemically reduced with 100 mM dithiothreitol (Roche) at 56°C for 30 min and alkylated using 100 mM iodoacetamide for 1 h ...
-
bioRxiv - Neuroscience 2024Quote: ... For quantitative PCR the FastStart Universal Probe system (Roche) was used ...
-
bioRxiv - Molecular Biology 2024Quote: ... and phosphatase inhibitors (04906837001, Roche) on ice for 30 min using a TissueLyser II (Qiagen ...
-
bioRxiv - Molecular Biology 2024Quote: ... The levels of βGAL and CAT were measured according to the protocol of the β-Gal Reporter Gene Assay kit (Roche, cat. # 11758241001) and the CAT ELISA kit (Roche ...
-
bioRxiv - Molecular Biology 2024Quote: Pulverized frozen gastrocnemius muscles were homogenized in Tripure Isolation Reagent (Roche, Switzerland), and total RNA was extracted as published34 ...
-
bioRxiv - Molecular Biology 2024Quote: ... qPCR reaction was assembled using Fast SYBR Green Mastermix (Applied Biosystem, Cat. No 4385612) and ran on a Lightcycler 480 II (Roche) instrument ...
-
bioRxiv - Molecular Biology 2024Quote: ... resuspended in PBS supplemented with 0.5% (v/v) Triton X-100 and cOmplete EDTA-free Protease Inhibitor Cocktail (Roche) (PI) ...
-
bioRxiv - Neuroscience 2024Quote: ... 1% NP40) supplemented with protease inhibitor (Complete EDTA-free, Roche) and phosphatase inhibitor (phosphoSTOP ...
-
bioRxiv - Neuroscience 2024Quote: ... and phosphatase inhibitor (phosphoSTOP, Roche) and sonicated (40 kHz for 10s ...
-
bioRxiv - Neuroscience 2024Quote: ... and one tablet of protease inhibitor cocktail (Roche 11836170001). Partway through homogenization ...
-
bioRxiv - Molecular Biology 2024Quote: ... The V4–V5 regions of 16S rRNA gene were amplified using specific primers and libraries were constructed using the Hyper Library Preparation Kit from Kapa Biosystems (Roche Diagnostics ...
-
bioRxiv - Biochemistry 2024Quote: ... The library was generated using the Transcriptor Reverse Transcriptase kit (Roche) and poly-dT and random hexamer primers ...
-
bioRxiv - Biochemistry 2024Quote: ... and the Light Cycler® 96 System (Roche, Pleasanton, CA) according to the manufacturer’s guidelines ...
-
bioRxiv - Biochemistry 2024Quote: ... RNA synthesis was performed using T7 RNA polymerase from Roche.
-
bioRxiv - Microbiology 2024Quote: ... and subjected to library construction with the KAPA Hyper Prep Kit (Roche, cat. no. 07962363001), according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... 200 µl) and purification by Solid Phase Reversible Immobilization with Kapa Pure Beads (Roche, cat ...
-
bioRxiv - Genomics 2024Quote: ... and KAPA Real Time Library Amplification Kit (KAPA Biosystems) following manufacturers manual ...
-
bioRxiv - Biochemistry 2024Quote: ... and AspN (Sequencing Grade, Roche) separately ...
-
bioRxiv - Genomics 2024Quote: ... Libraries were generated using KAPA Hyper Prep Kit (KAPA Biosystems) and KAPA Real Time Library Amplification Kit (KAPA Biosystems ...
-
bioRxiv - Molecular Biology 2024Quote: ... The V4–V5 regions of 16S rRNA gene were amplified using specific primers and libraries were constructed using the Hyper Library Preparation Kit from Kapa Biosystems (Roche Diagnostics ...
-
bioRxiv - Neuroscience 2024Quote: ... The pellet (pure synaptosomes) was dissolved in RIPA buffer with protease inhibitor cocktail (5056489001, Roche, Switzerland) and phosphatase inhibitor cocktails II and III ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 0.2 μL of KAPA HiFi HotStart polymerase (Roche, KK2502), was added to each well ...
-
bioRxiv - Cell Biology 2024Quote: ... and streptavidin alkaline phosphatase fast red (Roche Diagnostics).