Labshake search
Citations for Roche :
2101 - 2150 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... and protease inhibitor cocktail (Roche) and supplemented with 5 mM sodium orthovanadate and 1% Triton X-100.
-
bioRxiv - Immunology 2024Quote: ... followed by tissue digestion for 1 h at 37°C with Iscov’s digestion media containing 1 mg/ml Liberase TL (Roche), and 0.5 mg/ml DNAse (Thermo ...
-
bioRxiv - Immunology 2024Quote: ... 0.025 mg/ml DNAse I (#11284932001, Roche), and 0.5 mg/ml Collagenase D (#11088866001 Roche ...
-
bioRxiv - Immunology 2024Quote: ... and 0.5 mg/ml Collagenase D (#11088866001 Roche) for liver ...
-
bioRxiv - Immunology 2024Quote: ... 1 U HiFi enzyme mix (Expand High Fidelity PCR System, Roche, USA) and 1.5 mM MgCl2 (Roche ...
-
bioRxiv - Immunology 2024Quote: ... and 1.5 mM MgCl2 (Roche, Basel, Switzerland). The PCR conditions included an initial denaturation at 98 °C for 30 sec ...
-
eATP/P2X7R axis drives nanoparticle induced neutrophil recruitment in the pulmonary microcirculationbioRxiv - Immunology 2024Quote: ... and DAPI (D9564; Roche, Basel, Switzerland) in antibody diluent for 1 hour ...
-
bioRxiv - Immunology 2024Quote: ... lungs from BLM or WT mice were resected at the indicated timepoints and homogenized in a buffer of PBS and complete protease inhibitor (Roche). Lung homogenates were diluted 1:1 with 12N hydrochloric acid and incubated overnight at 120°C in well-sealed glass tubes ...
-
bioRxiv - Immunology 2024Quote: ... 12,5 μg/ml DNAse (Roche), and 1% FBS (Bodego ...
-
bioRxiv - Immunology 2024Quote: ... Whole transcriptome amplification was carried out using KAPA HiFi PCR Mastermix (Kapa Biosystems KK2602) with 2000 beads per 50-μl reaction volume ...
-
bioRxiv - Immunology 2024Quote: ... cDNA libraries were then prepared from RNA samples using the KAPA-stranded mRNA-Seq kit (Roche KK8421). The sequencing was performed using the Illumina NovaSeq 6000 system ...
-
bioRxiv - Immunology 2024Quote: ... 5% glycerol) supplemented with protease inhibitors (Complete mini, Roche), and immunoprecipitation was performed with 2μg of anti-survivin antibodies (RnD AF886 ...
-
bioRxiv - Immunology 2024Quote: ... Quantitative real-time PCR was performed using FastStart Universal SYBR Green master (Roche) and run on LightCycler 96 Systems (Roche) ...
-
bioRxiv - Immunology 2024Quote: Visceral white adipose tissues were diced and digested with 0.2 mg/ml Liberase TL (Roche) and 0.5 mg/ml DNase I (Sigma ...
-
bioRxiv - Immunology 2024Quote: ... 1× proteinase inhibitor cocktail (Roche, 5056489001), 2□mM PMSF ...
-
bioRxiv - Immunology 2024Quote: ... in HEPES buffer containing Liberase Blendzyme 3 (70 mg/ml; Roche) and DNaseI (30 mg/ml ...
-
bioRxiv - Immunology 2024Quote: ... System performance was assessed by an Fc/2 standard obtained from a commercial mAb preparation (Herceptin; Roche Diagnostics).
-
bioRxiv - Immunology 2024Quote: Deamidation of a monoclonal IgG1 (Herceptin; Roche Diagnostics, Penzberg, Germany) was induced by incubating the antibody at a concentration of 1.0 mg/ml in 200 mM ammonium bicarbonate (pH 8.4 ...
-
bioRxiv - Immunology 2024Quote: ... One hundred ng of genomic DNA was used for PCR amplification of the target loci using KAPA HiFi HotStart PCR kit (Roche) and the primer sets in Table S1 ...
-
bioRxiv - Immunology 2024Quote: ... and 50 ug/mL DNase I (Roche) for 30 min ...
-
bioRxiv - Immunology 2024Quote: ... 320 U/mL Collagenase D (Roche), and 50 ug/mL DNase I (Roche ...
-
bioRxiv - Immunology 2024Quote: ... and digested for 1 hour at 37°C in 94 μg/mL DNase I (Roche) and 250 μg/mL collagenase type I and 250 μg/mL collagenase type IV (Worthington Biochemicals) ...
-
bioRxiv - Immunology 2024Quote: ... The other 18 popliteal LNs were digested with 0.25 mg of Liberase DL (Roche, Indianapolis, IN) per mL of EHAA media with DNAse 1(Worthington ...
-
bioRxiv - Immunology 2024Quote: ... DNase 12.5 U mL−1 (Roche, SigmaAldrich, Switzerland)) at 37°C on an orbital shaker for 45 min at 105 rpm ...
-
bioRxiv - Immunology 2024Quote: ... and 1% complete EDTA-free protease inhibitor cocktail (Roche, Cat. No. 11873580001); pH 8.0] for 45 minutes on ice ...
-
bioRxiv - Immunology 2024Quote: ... NK cells were cultured for the indicated amount of time with or without human IL-2 (TECINTM; teceleukin, ROCHE), human IL-15 (247-IL/CF ...
-
bioRxiv - Immunology 2024Quote: ... 20 U/mL of DNAse-I (Roche)) followed by incubation at 37°C for 1h with shaking ...
-
bioRxiv - Immunology 2024Quote: ... 100 μg/mL streptomycin with 1 mg/mL collagenase A (Roche), 20 U/mL of DNAse-I (Roche) ...
-
bioRxiv - Immunology 2024Quote: ... DNase 12.5 U mL−1 (Roche, Sigma-Aldrich ...
-
bioRxiv - Microbiology 2024Quote: ... libraries were constructed using the KAPA Hyper Prep Kit (Roche, cat. no. 07962363001) and TruSeq DNA UD Indexes adapters (Illumina ...
-
bioRxiv - Microbiology 2024Quote: ... The fragmented samples were purified and concentrated to a volume of 13 µl using the SPRI method (Solid Phase Reversible Immobilization) with Kapa Pure Beads (Roche, cat. no. 07983298001). Elution was performed for 10 minutes at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... using KAPA Sybr Fast Universal qPCR master mix (Kapa biosystems (#KK4602). Mean strain DNA quantities were calculated using a standard curve to determine relative abundance of S ...
-
bioRxiv - Immunology 2024Quote: ... and 1% Triton X-100) including protease inhibitor cocktail (Roche). The lysate was incubated over night at 4°C with anti-His beads (Solarbio) ...
-
bioRxiv - Microbiology 2024Quote: ... Fragment size selection was carried out using Kapa HyperPure Beads (Roche, cat. no. 07983298001) in a two-step purification with a sample-to- reagent volume ratio of 1 ...
-
bioRxiv - Genomics 2024Quote: ... Pooled library concentration was measured with a KAPA Library quantification kit (Roche, Wilmington, MA). Library quality control was performed on an Illumina iSeq100 sequencer (Illumina ...
-
bioRxiv - Genomics 2024Quote: ... or 3 µl of direct lysis extract were used as template in 50 µl PCR reactions using KAPA HiFi HotStart ReadyMix (Roche), primers P3/4 and P5 (Supplementary Table 2) ...
-
bioRxiv - Genomics 2024Quote: ... Sequencing adaptors and barcodes were added with a second round of PCR using the KAPA HiFi HotStart ReadyMix (Roche), primers P6 and P7 (Supplementary Table 2) ...
-
bioRxiv - Genomics 2024Quote: ... supplemented with protease inhibitor (5892791001; Roche). Samples were cut into < 1 mm pieces ...
-
bioRxiv - Genomics 2024Quote: ... Pooled library concentration was measured by Universal qPCR Master Mix (Kapa Biosystems, Wilmington, MA). Library quality control was performed on an Illumina iSeq100 sequencer (Illumina ...
-
bioRxiv - Immunology 2024Quote: ... Lungs were resected and minced with scissors before incubation in a collagenase buffer containing 1 mg/mL Collagenase-A (Roche), 2000U DNaseI (Sigma) ...
-
bioRxiv - Microbiology 2024Quote: ... 300mM NaCl in dH2O) supplemented with 1X cOmplete™ EDTA-free protease inhibitor cocktail (Roche # 11873580001), 1mM Na3VO4 and 1mM NaF for 1 h at 4°C with rotation ...
-
bioRxiv - Microbiology 2024Quote: ... 300mM NaCl in dH2O) supplemented with 1X cOmplete™ EDTA-free protease inhibitor cocktail (Roche # 11873580001), 1mM Na3VO4 and 1mM NaF for 1 h at 4°C with rotation ...
-
bioRxiv - Microbiology 2024Quote: ... Fast SYBR Green Master Mix (Roche, cat# 4913850001) was used ...
-
bioRxiv - Microbiology 2024Quote: ... which were then blotted onto positively charged nylon membranes (Roche, Germany). The RNA bands were fixed to the filter by UV-crosslinking for 2 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... prepared for NGS by shotgun library preparation (KAPA HyperPrep Kits, Roche), and then sequenced on either MiSeq (MiSeq 500-cycle sequencing kit version 2 ...
-
bioRxiv - Immunology 2024Quote: ... and 125 U/mL collagenase D (Roche) using an orbital shaker at 37℃ ...
-
bioRxiv - Immunology 2024Quote: ... this contained 1× KAPA HiFi master mix (Roche, #KK2601), 0.5 μM Smart-seq3 forward primer (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATTGCGCAATG ...
-
bioRxiv - Immunology 2024Quote: ... 20 mM PMSF) containing protease inhibitor cocktail (Roche). Whole cells were incubated on ice for 20 min and collected by centrifugation at 17,000g for 15 min ...
-
bioRxiv - Immunology 2024Quote: ... on a Light Cycler 480 machine (Roche). Three technical replicates were performed for each sample ...
-
bioRxiv - Immunology 2024Quote: ... beads and lysis buffer (20 mM Tris pH 7.4, 120 mM NaCl, 1 mM EDTA, 1% Triton-X-100, 0.5% sodium deoxycholate, 1× protease inhibitor cocktail [Roche])) ...