Labshake search
Citations for Roche :
2051 - 2100 of 7633 citations for ssc mir 758 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... for 1 h at RT and 20 μg/mL Laminin (Roche, Switzerland) for 4 h at 37 °C ...
-
bioRxiv - Genetics 2022Quote: ... The RT-qPCR was done in duplicate on a Lightcycler 480 (Roche) with SYBR green for detection (2,5 μl of mastermix ...
-
bioRxiv - Physiology 2021Quote: ... RT-qPCR was performed in duplicate with the LightCycler 480 (Roche Diagnostics) instrument using LightCycler 384-well plates with sealing foil (Roche) ...
-
bioRxiv - Cancer Biology 2020Quote: ... The RT-qPCR cycling analysis was performed by LC-480 device (Roche). qBasePlus software 3.2 (http://www.biogazelle.com ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed with the Light Cycler 96 (Roche, Geneva, Switzerland) using iQ SYBR Green Supermix (170-8882AP ...
-
bioRxiv - Cancer Biology 2022Quote: ... RT-qPCR was performed using SYBR Fast qPCR Master Mix (Kapa Biosystems) on a Light Cycler 480 (Roche) ...
-
bioRxiv - Evolutionary Biology 2019Quote: Dengue virus was quantified via RT-qPCR using the LightCycler 480 (Roche). We used the TaqMan Fast Virus 1-Step Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... pH 7.4 at room temperature (RT)) supplemented with protease inhibitor cocktail (Roche) and Benzonase (Merck ...
-
bioRxiv - Plant Biology 2022Quote: ... The RT-QPCRs were performed using a LightCycler480 machine (Roche; Mannheim, Germany) and data were extracted using LightCycler480 software ...
-
bioRxiv - Plant Biology 2023Quote: ... RT-qPCR reactions were performed on a LightCycler 96 (Roche, Mannheim, Germany) using qPCRBIO SyGreen Mix (PCR Biosystems ...
-
bioRxiv - Cancer Biology 2023Quote: ... RT-qPCR is performed using The LightCycler 480 SYBR Green I (Roche), and the reaction was run at LightCycler 480 Instrument II (Roche) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... We analysed RT-qPCR reaction using the LightCycler® 96 Software (Roche). We calculated viral genome concentration (Vg/mL ...
-
bioRxiv - Molecular Biology 2023Quote: ... RT-qPCR was run on a LightCycler 480 II (Roche Applied Science) using 384 well plates (see RT-qPCR section for thermocycling details) ...
-
bioRxiv - Molecular Biology 2023Quote: ... RT-qPCR was run on a LightCycler 480 II (Roche Applied Science) using 384 well plates ...
-
bioRxiv - Synthetic Biology 2023Quote: ... We measured RT-qPCR reaction on a LightCycler® 96 Instrument (Roche) using the SYBR-green channel and with cycling conditions as follows ...
-
bioRxiv - Physiology 2024Quote: ... RT-qPCR was performed in duplicate with the LightCycler 480 (Roche Diagnostics) instrument using LightCycler 384-well plates with sealing foil (Roche) ...
-
bioRxiv - Immunology 2020Quote: ... Prothrombin time was measured using the Coagucheck (Roche) meter ...
-
bioRxiv - Developmental Biology 2021Quote: ... Pax3 digoxigenin (DIG) - labeled antisense riboprobes were transcribed from linearized gene-specific probes (PCR DIG probe Synthesis Kit, Roche). WISH experiment was performed as follows ...
-
bioRxiv - Neuroscience 2021Quote: ... The library amplification step included 6-7 PCR cycles and was performed using the KAPA Library Amplification kit (Roche). The final Hi-C library was purified using SPRIselect beads and the quality and size of the library (approximately 500 bp ...
-
bioRxiv - Microbiology 2021Quote: ... The 16S rRNA V3–V4 amplicon was amplified using a KAPA HiFi HotStart ReadyMix PCR Kit (KAPA BioSystems, USA). the amplicon PCR forward primer (5’-CCTACGGGNGGCWGCAG-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 were purified according to the instructions of the manufacturer using the High Pure PCR Template Preparation Kit (Roche) followed by RNAse A digest and a final purification with the High Pure PCR Product Purification Kit (Roche).
-
bioRxiv - Microbiology 2021Quote: ... hygromycin B phosphotranferase (HYG) or blastacidin S deamidase gene (BSD) generated using the PCR DIG Probe Synthesis Kit (Roche). The blot was developed according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2022Quote: ... PCR analyses confirmed mouse genotypes with DNA isolated from ear biopsies using the KAPA Mouse Genotyping Kits (Kapa Biosystems). All PCR primers are listed in Supplementary Table 1.
-
bioRxiv - Developmental Biology 2022Quote: ... The library was enriched using 14 PCR cycles and quantified with Kapa NGS library quantification kit (Kapa Biosystems, KK4824) before pooling at a concentration of 20nM ...
-
bioRxiv - Cancer Biology 2022Quote: ... Post-capture amplification was performed using the KAPA HiFi Hot Start PCR ReadyMix Kit (KAPA Biosystems, Catalogue no. KK2601). Post-capture amplified libraries were quality controlled and quantified using a Tapestation 2200 with the High Sensitivity reagents.
-
bioRxiv - Developmental Biology 2022Quote: ... and PCR products were quantified fluorometrically using the KAPA SYBR FAST qPCR Master Mix (2X) Kit (KR0389, KAPA Biosystems).
-
bioRxiv - Genetics 2022Quote: ... Total Ty1-copia sequences labeled with DIG were prepared as probes using the PCR-DIG Probe Synthesis Kit (Roche). ImageJ and Calculator software (http://cels.uri.edu/gsc/cndna.html ...
-
bioRxiv - Developmental Biology 2019Quote: Digoxigenin (DIG)-labelled probes for in situ hybridization was synthesized by PCR using DIG RNA labelling kit (Roche #11175025910). The probes for Ssadh and CG33791 (αKDH ...
-
bioRxiv - Genetics 2019Quote: ... Gene expression was detected by RT-PCR using gene specific primers, (FW:AAAGCAGAACTGTTTGGCGG, RV:TTGGGACTGATGGACAAGGC) and a SYBR green nucleic acid-labeling SYBR FAST kit (Kapa Biosystems) in a Lightcycler 480 (Roche) ...
-
bioRxiv - Plant Biology 2020Quote: ... qRT-PCR reaction was prepared using a LightCycler® 480 SYBR Green I Master kit (Roche Diagnostics, Mannheim, Germany) and the PCR was performed with a LightCycler® 480 Instrument II (384-well ...
-
bioRxiv - Cell Biology 2019Quote: ... The barcoded sequencing libraries were quantified by quantitative PCR using the KAPA Library Quantification Kit (KAPA Biosystems, Wilmington, MA). Sequencing libraries were sequenced using Novaseq 6000 (Illumina ...
-
bioRxiv - Genomics 2019Quote: ... Cells were then harvested and genomic DNA was extracted with a High Pure PCR Template Preparation Kit (Roche 11796828001). MinION runs were performed on R9 with 400-500ng purified DNA per sample following library preparation with Ligation Sequencing Kit 1D (ONT SQK-LSK108) ...
-
bioRxiv - Genomics 2020Quote: ... Bisulfite converted DNA was then used as template for PCR amplification with KAPA HiFi HotStart Uracil kit (Roche, KK2801) using primers surrounding Site 1 in intron 8 of the Fto gene ...
-
bioRxiv - Genomics 2019Quote: All 5’ fragments were amplified off the array using HSSF-ATGC and DO_15R_PU (Supplemental Table 8) with KAPA HiFi HotStart Uracil+ ReadyMix PCR Kit (Kapa Biosystems) and stopped before plateauing ...
-
bioRxiv - Genomics 2020Quote: ... The fragmented DNA was then ligated with dual-indices using a KAPA Hyper prep PCR-free library kit (Roche) according to the manufacturer’s directions ...
-
bioRxiv - Cell Biology 2020Quote: ... The barcoded sequencing libraries were quantified by quantitative PCR using the KAPA Library Quantification Kit (KAPA Biosystems, Wilmington, MA). Sequencing libraries were loaded on a NovaSeq 6000 (Illumina ...
-
bioRxiv - Immunology 2021Quote: ... The PCR products were used to synthesize dsRNA using a T7 RNA Polymerase Kit (Sigma-Aldrich RPOLT7-RO ROCHE). Generated dsRNAs were treated with TURBO DNA-free Kit (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: Genomic DNA was extracted from BHI broth cultures using the High Pure PCR template preparation kit (Roche, Potsdam, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... mRNA expression levels were determined by qRT-PCR with KAPA SYBR FAST qPCR Master Mix Kit (Kapa Biosystems, KK4610). cDNA was synthesized from human cells using SuperPrep II Cell Lysis & RT Kit (TOYOBO ...
-
bioRxiv - Neuroscience 2022Quote: ... and the pool was quantified by qRT-PCR using the KAPA Library Quantification Kit - Illumina/Universal (KAPA Biosystems, KK4824) in combination with the Life Technologies Viia 7 real time PCR instrument ...
-
bioRxiv - Plant Biology 2022Quote: ... qRT-PCR reactions were performed using the KAPA SYBR FAST qPCR Master Mix (2X) Kit (KAPA Biosystems, Wilmington, USA) on the QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... was introduced by site directed mutagenesis on C-terminal SNAP-tagged H3.1 (HIST1H3C coding sequence cloned in pSNAPm) and H3.3 (H3F3B coding sequence cloned in pSNAPm) encoding plasmids with a PCR master kit (Roche) and the primers indicated in Supplementary table 2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Highly sensitive DNAprobes labelled with digoxigenin-dUTP were generated using the PCR digoxigenin probe synthesis kit (Roche Applied Science) according to the manufacturer’s recommendations ...
-
bioRxiv - Genomics 2023Quote: ... Quantitative PCR was carried out on standards and test samples using the LightCycler 480 Probes Master kit (Roche, 04707494001) with inverted terminal repeat probe and primer sequences indicated in Table S4.
-
bioRxiv - Genomics 2023Quote: ... Library construction was performed on the 5 ng of pooled PCR amplicons using the KAPA HyperPrep Kit (Roche 07962363001) and NEXTFLEX Unique Dual Index Barcodes (7.5µM final concentration ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and the molarity of the library was measured using quantitative PCR with the KAPA Library Quantification Kit (Roche KK4824) on a BioRad CFX Connect thermal cycler ...
-
bioRxiv - Genomics 2023Quote: DNA extraction for sequencing with Illumina was done using High Pure PCR Template Preparation Kit from Roche (Mannheim, Germany) according to the manufacturers’ instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... The plasmid backbones and DNA fragments were amplified using the KAPA HiFi HotStart PCR kit (Kapa Biosystems, Boston, USA) and the primers described in Table S3 ...
-
bioRxiv - Cell Biology 2023Quote: ... Approximately 20 x 106 cells were used for isolating genomic DNA with High Pure PCR Template Preparation Kit (Roche) as described by the manufacturer ...
-
bioRxiv - Developmental Biology 2023Quote: Genotyping of ESCs and mouse tails were performed by PCR using KAPA Mouse Genotyping Kit (Roche, Cat. No. KK7302). Specific protocol followed the reagent instructions ...