Labshake search
Citations for Roche :
2251 - 2300 of 8038 citations for ssc mir 758 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... RT-qPCR was performed with the LightCycler® 480 Instrument (Roche Life Science) and data were analyzed according to manufacturer’s instruction (Roche LightCycler® 480 software ...
-
bioRxiv - Immunology 2023Quote: ... The RT-qPCR was run on a Roche LightCycler 480 (Roche Diagnostics Ltd) using the conditions outlined in Table 4.
-
bioRxiv - Molecular Biology 2023Quote: ... The RT-qPCR was run on a LightCycler 480 II (Roche Applied Science) using 384 well plates ...
-
bioRxiv - Cell Biology 2024Quote: ... RT-qPCR was performed with a Roche Lightcycler 480 (Roche Molecular Systems, Inc.). Each reaction contained 1µl of cDNA ...
-
bioRxiv - Genetics 2024Quote: ... RT- qPCR was performed in triplicate with the LightCycler 480 instrument (Roche Diagnostics) and LightCycler 384-well plates with sealing foil (Roche Diagnostics) ...
-
bioRxiv - Cell Biology 2020Quote: ... Target regions were amplified by using specific PCR primers (ETV2_F: CACTCGGGATCCGTTACTCC; ETV2_R: GTTCGGAGCAAACGGTGAGA, KDR_F: CAAGCCCTTTGTTGTACTCAATTCT; KDR_R: ATTAATTTTTCAGGGGACAGAGGGA) and KAPA HiFi HotStart PCR kit (KAPA Biosystems, Cat No. KK2601). Sanger sequencing (Genewiz ...
-
bioRxiv - Microbiology 2020Quote: ... Both the pET28a vector and the Rv1630 gene amplification product (1446 bp) were purified using the PCR quick spin kit (Roche) following the manufacturer’s protocol ...
-
bioRxiv - Pathology 2022Quote: ... We used genomic DNA isolated from ear tissue with a High Pure PCR Template Preparation Kit (Roche Diagnostics, Basel, Switzerland). The transgene was detected using RT2 qPCR Primer Assays from Qiagen (Venlo ...
-
bioRxiv - Genomics 2022Quote: ... The libraries were quality controlled on an Agilent 2100 Bioanalyzer with the DNA 7500 assay for size and the concentration was estimated using quantitative PCR with the KAPA Library Quantification Kit Illumina Platforms (Roche).
-
bioRxiv - Genomics 2020Quote: ... Entire material of one conversion was equally distributed to a 96-well plate and amplified via PCR using KAPA HiFi Uracil+ Kit (Roche) in a total volume of 16µl ...
-
PHF2 regulates homology-directed DNA repair by controlling the resection of DNA double strand breaksbioRxiv - Molecular Biology 2019Quote: ... cDNA synthesis and PCR amplification were carried out in the same tube using the qScript One-Step SYBR Green qRT-PCR Kit (Quantabio) and a LightCycler480 II (Roche). All reactions were performed in triplicate ...
-
bioRxiv - Microbiology 2019Quote: ... RNA transcripts of the cloned 5’UTRB7 fragments were produced in vitro from the resulting purified PCR products by using the T7 Transcription kit (Roche) and labeled by using the RNA 3’ end biotinylation kit (Pierce) ...
-
bioRxiv - Plant Biology 2019Quote: ... with 340bp insert size according to KAPA Library Preparation Kit with no PCR Library Amplification/Illumina series (Roche-Kapa Biosystems) protocol and sequenced on HiSeq2000 (v4 ...
-
bioRxiv - Plant Biology 2019Quote: ... with 340bp insert size according to KAPA Library Preparation Kit with no PCR Library Amplification/Illumina series (Roche-Kapa Biosystems) protocol and sequenced on HiSeq2000 (v4 ...
-
bioRxiv - Genomics 2021Quote: ... were used to prepare single-end (SE) libraries with an insert size of 300 bp using a PCR-free workflow with the KAPA HyperPrep Kit (Roche) following manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... were generated cloning each enhancer from the genomic zebrafish DNA DNA using KAPA Long Range HotStart PCR kit (Kapa Biosystems) and cloned into the E1b:GFP:AC-DS vector (102417 Addgene (Chong-Morrison et al. ...
-
bioRxiv - Microbiology 2020Quote: ... gRNA encoding DNA sequences were amplified in a two-step nested PCR using KAPA HiFi HotStart ReadyMixPCR Kit (Kapa Biosystems) and sequenced on an Illumina NextSeq (High Output ...
-
bioRxiv - Cell Biology 2020Quote: ... qRT-PCR was performed with Kapa SYBR Fast qPCR Kit Master Mix (2×) Universal (Kapa Biosystems Ltd., Wilmington, MA, USA) on a CFX connect real-time system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2022Quote: ... and by quantitative PCR (qPCR) using a KAPA Library Quantification Kit for Illumina sequencing platforms (Kapa Biosystems, Roche, Wilmington, MA). Samples were multiplexed and sequenced with a 15% spike-in of PhiX DNA in an Illumina NovaSeq platform (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... and by quantitative PCR (qPCR) using a KAPA Library Quantification Kit for Illumina sequencing platforms (Kapa Biosystems, Roche, Wilmington, MA). Samples were multiplexed and sequenced with a 15% spike-in of PhiX DNA in an Illumina NovaSeq platform (Illumina ...
-
bioRxiv - Cancer Biology 2022Quote: ... genomic (g)DNA was extracted both from primary Irf4−/− tumours as well as FACS-sorted control B220+mIgM- BM fr.A-D cells using the High Pure PCR Template Preparation kit from Roche (11796828001). Integrity of resultant gDNA was confirmed in a 2 % Agarose gel ...
-
bioRxiv - Cancer Biology 2022Quote: ... mRNA expression levels were determined by qRT-PCR with KAPA SYBR FAST qPCR Master Mix Kit (Kapa Biosystems, no. KK4610). Relative expression levels were normalized to human ACTB or mouse Actb ...
-
bioRxiv - Microbiology 2020Quote: ... The membrane was hybridized with digoxigenin-labeled DNA probes synthesized with a PCR DIG probe synthesis kit (Roche Molecular Biochemicals) as recommended by the supplier ...
-
bioRxiv - Bioengineering 2021Quote: Biotin-labeled dsDNA template was first amplified from the plasmid encoding the template design with biotin-labeled primers using KAPA HiFi HotStart ReadyMix PCR Kit (Roche) for 35 cycles (98°C for 20 s ...
-
bioRxiv - Cancer Biology 2022Quote: ... 500-1000 ng of sheared DNA was used as a template for a 6-cycle PCR to construct a fragmented library using the KAPA HTP Library Preparation Kit (Roche). Exome enrichment was performed using SeqCap EZ Enrichment Kit (Roche ...
-
bioRxiv - Cell Biology 2022Quote: ... according to manufacturer’s protocol. Quantitative PCR was performed using SensiMixTM II Probe Kit (Cat#. BIO-83005) with Universal ProbeLibrary (Roche Diagnostics), and the CFX96 Touch System (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2022Quote: ... The PCR products were then purified and reverse transcribed with digoxigenin labeling using a DIG RNA labelling kit (Roche, Switzerland). For dissected adult pituitary or 5-8 dpf larvae ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Libraries were subsequently index-amplified for 20 cycles using a KAPA HiFi HotStart PCR kit (Kapa Biosystems, Wilmington, Ma. USA) in 50-μl reactions following the manufacturer’s guidelines ...
-
bioRxiv - Genetics 2019Quote: ... located in exon 18 and reverse primer 5’-TTGGTGGCTACAAAGACGTG-3’ located in exon 22 using the One Tube reverse transcription-PCR reaction kit (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2019Quote: The relative concentration of the resulting DNA ligated-probes was assessed by quantitative PCR (qPCR) using the LightCycler 480 SYBR Green I Master kit (Roche). 3.5 µl of diluted samples was used to assemble a 10 µl reaction and run on a Light Cycler 480 II (Roche ...
-
bioRxiv - Plant Biology 2021Quote: ... A PCR master mix was prepared with the LightCycler 480 SYBR Green I Master Kit (Roche Applied Science, Mannheim, Germany). Each reaction was performed in a total volume of 10 μL ...
-
bioRxiv - Cancer Biology 2020Quote: ... Exon 1 and exon 3 digestion products were purified using the High pure PCR product purification kit (Roche, Basel, Switzerland) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2021Quote: Pitx1 WISH were performed on 40-45 somite stage mouse embryos (E12.5) using a digoxigenin-labeled Pitx1 antisense riboprobe transcribed from a cloned Pitx1 probe (PCR DIG Probe Synthesis Kit, Roche), as previously described in (Kragesteen et al ...
-
bioRxiv - Cell Biology 2019Quote: All genotyping was done using the HotStart Mouse Genotyping Kit with its instructed PCR reaction set up from KAPA Biosystems. For the NF1Afl/fl genotype ...
-
bioRxiv - Genetics 2021Quote: We extracted DNA from nail samples using the ISOHAIR (Nippon Gene) and oral mucosa samples using the High Pure PCR Template Preparation Kit (Roche).
-
bioRxiv - Neuroscience 2021Quote: ... the circular DNA fragment containing the shotV104 breakpoint region was amplified using a High Fidelity PCR Kit (Eppendorf and Roche). PCR products were gel-extracted ...
-
bioRxiv - Genomics 2019Quote: ... Genome libraries were prepared using the KAPA Hyper Library Preparation Kit with Standard PCR Library Amplification (Kapa Biosystems, Wilmington, MA) and sequenced on an Illumina MiSeq using V3 sequencing chemistry (Illumina Inc. ...
-
bioRxiv - Microbiology 2021Quote: ... Radiolabeled probe was generated by purifying a digested (Ncol; 1 cut) pCpG vector DNA using High Pure PCR product Purification Kit (Roche) followed by radiolabeling the probe using Random Prime DNA labeling kit (Roche) ...
-
bioRxiv - Immunology 2022Quote: ... and 11-week infected half brains and liver lobes of mice (n=4/group) was extracted and purified using a High Pure PCR Template Prep Kit (Roche). DNA concentration of each sample was determined via NanoDrop ...
-
bioRxiv - Cell Biology 2022Quote: Following library construction as per manufacturer’s instructions ST libraries were quantified using the KAPA-Illumina PCR quantification kit (KAPA Biosystems) and pooled at 4nM concentration with a sample ratio corresponding to the surface area of tissue coverage obtained from the H&E imaging ...
-
bioRxiv - Cancer Biology 2022Quote: The activity of telomerase in the cell lines was detected using the TeloTAGGG telomerase PCR ELISA Kit (Roche, Cat# 12013789001). The assay was performed according to the manufacturer’s instructions and repeated in triplicate ...
-
bioRxiv - Genomics 2022Quote: ... and P5 and P7 adapters were ligated per pool following the KAPA HiFi Hotstart PCR kit standard protocol (Kapa Biosystems). Pooled samples were then combined into one sample and cleaned as before ...
-
bioRxiv - Microbiology 2022Quote: ... the ligated product was amplified by 12 PCR cycles using the Kapa Hifi Hotstart NGS library amplification kit (Kapa Biosystems), followed by purification with 0.6×AMPure XP ...
-
bioRxiv - Plant Biology 2022Quote: ... and 72°C for 20 s) containing the Spartina cDNAs with the PCR DIG Probe Synthesis Kit (Roche, Cat.11636090910) using the SaHKT1 transcripts specific primers (Forward primer ...
-
bioRxiv - Neuroscience 2024Quote: ... Genomic PCR for ATP13A2 floxed or KO alleles was performed using 100 ng genomic DNA and the Kapa2g Fast HotStart PCR Kit (Roche). PCR primers included a forward primer (5’-CTGCAGCTTCGAGAGGAAAG-3’) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The short insert paired-end libraries for the whole genome sequencing were prepared with PCR free protocol using KAPA HyperPrep kit (Roche). The library was sequenced on NovaSeq 6000 (Illumina ...
-
bioRxiv - Evolutionary Biology 2023Quote: Antisense probes were synthesized using purified PCR products (1 μg per reaction) (supplementary table S16) and DIG RNA labeling Kit (T7) (Roche), following the manufacturer instructions ...
-
bioRxiv - Systems Biology 2023Quote: ... the entire eluate was used as input for a 300 μl PCR reaction mastermix with the KAPA HiFi HotStart DNA Polymerase kit (Roche Sequencing Solutions Inc ...
-
bioRxiv - Microbiology 2023Quote: ... Probes were obtained by PCR using the primers pGK-S55 and pGK-S53 (Table S1) and labelled with the PCR DIG Probe Synthesis Kit (Roche) according to the manufacturer and revealed using the DIG Luminescent Detection Kit and DIG Easy Hyb (Roche).
-
bioRxiv - Molecular Biology 2023Quote: Genomic DNA was extracted from mouse tail tip or ear notch biopsies using the High Pure PCR Template Preparation Kit (Roche) following the manufacturer’s protocol ...