Labshake search
Citations for Roche :
2101 - 2150 of 7633 citations for ssc mir 758 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... six reverse primers (10 μM) and Robust DNA polymerase from the KAPA2G Robust PCR Kit (Kapa Biosystems, Wilmington, MA). Cycling conditions were ...
-
bioRxiv - Plant Biology 2024Quote: We fragmented 700 ng of high-molecular-weight DNA using a Covaris S220 sonicator and a WGS library was generated for both species using the KAPA Hyper Prep kit with a PCR-free protocol according to the manufacturer’s instructions (Roche). We applied final size selection using a 0.7-fold ratio of AMPureXP beads ...
-
bioRxiv - Molecular Biology 2024Quote: Analysis of ChIP-purified DNA by quantitative PCR (qPCR) was performed using KAPA SYBR Fast qPCR kit (KAPA Biosystems) and StepOnePlus real-time PCR systems (Life Technology ...
-
bioRxiv - Bioengineering 2020Quote: ... PCR amplification was performed using KAPA HiFi PCR Mix (Kapa Biosystems KK2602). Specifically ...
-
bioRxiv - Bioengineering 2022Quote: ... PCR was performed using 12.5 μl KAPA2G Fast PCR mastermix (KAPA Biosystems), containing reaction buffer ...
-
bioRxiv - Immunology 2020Quote: ... qRT-PCR was performed using the LightCycler 480 II PCR System (Roche) with program as followed ...
-
bioRxiv - Neuroscience 2019Quote: ... qRT-PCR was performed using the SYBR Green PCR Master Mix (Roche) on a ViiA7 Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2019Quote: ... Quantitative PCR (qRT– PCR) was performed on a 480 LightCycler thermocycler (Roche) using the manufacturer’s instructions with Light cycler 480sybr green I master (Roche ...
-
bioRxiv - Microbiology 2019Quote: ... A second PCR step using the Expand High Fidelity PCR System (Roche) allowed the incorporation of the Illumina MiSeq version 2 indexes and adapters ...
-
bioRxiv - Immunology 2021Quote: ... qRT-PCR was performed using the LightCycler 480 II PCR System (Roche) with the following program ...
-
bioRxiv - Immunology 2019Quote: ... 2.5 ×105 haemocytes from each treatment/time point were added to lysis buffer (50mM potassium phosphate, 2mM EDTA, 1mM DTT and a proteinase inhibitor cocktail (Roche cOMPLETE™ Mini kit) and centrifuged at 14,000 × g for 10 minutes at 4°C ...
-
Nucleo-cytoplasmic shuttling of splicing factor SRSF1 is required for development and cilia functionbioRxiv - Molecular Biology 2020Quote: ... This was followed by SybrGreen detection system (Lightcycler 2x SybrGreen Mix, Roche, #04707516001).
-
bioRxiv - Evolutionary Biology 2021Quote: ... Chromosome slides were subjected to the detection with avidin-FITC (Roche, Basel, Switzerland) and then counterstained with DAPI in VECTASHIELD Antifade Mounting Medium (Vector Laboratories ...
-
bioRxiv - Biochemistry 2022Quote: ... QPCR was performed using Roche’s SYBER Green detection in the Lightcycler 480 (Roche). Quantification of mRNA was performed by relative normalization to the constitutive gene GAPDH ...
-
bioRxiv - Plant Biology 2021Quote: ... Detection was performed with the BM-chemiluminescence blotting substrate (Roche catalogue no 11500708001) and FusionFx7 imaging system (PeqLab) ...
-
Integrative analyses of the RNA modification machinery reveal tissue- and cancer-specific signaturesbioRxiv - Molecular Biology 2019Quote: ... Detection of the labelling was performed using the ChromoMAP DAB (760-159, Roche). Sections were counterstained with hematoxylin (760-2021 ...
-
bioRxiv - Microbiology 2020Quote: ... the labeled DNAs were detected using a CSPD-based chemiluminescence detection system (Roche) (26) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Detection of tagged constructs was done using: HA-peroxidase antibody (Roche, ref: 12013819001), anti- TAP antibody (Thermofisher Scientific ...
-
Glutamine synthetase mRNA releases sRNA from its 3’UTR to regulate carbon/nitrogen metabolic balancebioRxiv - Microbiology 2022Quote: ... The RNAs were visualized by using a detection system with digoxigenin (DIG) (Roche) and then captured using the imaging system ChemiDoc XRS Plus (BioRad) ...
-
bioRxiv - Cell Biology 2022Quote: ... The cells were lysed in Cell Death Detection Lysis Buffer (Roche, Basel, Switzerland) for analysis of insulin content ...
-
bioRxiv - Developmental Biology 2023Quote: ... Detection was performed using an anti-digoxigenin AP-conjugate antibody (Roche, Cat# 11093274910) followed by an NBT/BCIP reaction (Roche) ...
-
bioRxiv - Plant Biology 2024Quote: ... Chemiluminescent detection of DIG-labelled DNA was carried using CDP-Star solution (Roche) before detection.
-
bioRxiv - Developmental Biology 2021Quote: ... RT-qPCR was performed using KAPA SYBR® FAST Master Mix (KAPA Biosystems) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... RT-qPCRs were performed using 1× LightCycler 480 SYBR Green I Master (Roche), 0.5 μM primers (Suppl ...
-
bioRxiv - Cancer Biology 2020Quote: ... RT-qPCR was performed on a LightCycler® 480 II (Roche Life Science) using SYBR® Premix Ex Taq(tm ...
-
bioRxiv - Molecular Biology 2022Quote: ... RT-qPCR was subsequently performed as described [23] using Sybr green (Roche, 06924204001) on The LightCycler 480 System ...
-
bioRxiv - Genomics 2022Quote: ... RT-qPCR was performed using LightCycler 480 SYBR Green I master mix (Roche). For quantification of gene expression ...
-
bioRxiv - Immunology 2022Quote: ... slides were blocked at RT for 1 h in 1x Blocking reagent (Roche) and incubated at 4°C over night with a phospho-histone H2AX (pSer139 ...
-
bioRxiv - Plant Biology 2022Quote: ... RT-qPCR assays were carried out on LightCycler LC480 II (Roche Diagnostics, Germany) using SYBR Green Jumpstart Taq Ready mix (Sigma-Aldrich ...
-
bioRxiv - Plant Biology 2021Quote: ... RT-qPCR was performed using KAPA SYBR FAST qPCR master mix (Kapa Biosystems) with gene-specific primers (Supplementary Table 6 ...
-
bioRxiv - Immunology 2021Quote: ... RT-qPCR was performed in a LightCycler® 2.0 instrument (Roche, Mannheim, Germany), using 45 cycles of the following program ...
-
bioRxiv - Genetics 2019Quote: ... RT-qPCR reactions were carried out in quadruple on a LC480 machine (Roche). The reaction mix consisted of cDNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... a minimum of 50ng of RNA was used to prepare cDNA (Roche RT) and splice isoform specific PCRs were performed (Sigma Aldrich High fidelity Taq ...
-
bioRxiv - Biophysics 2022Quote: GGCAGCGCTACCATAACGGA-3’) (11) by RT-qPCR was performed using LightCycler 480 II (Roche). GAPDH mRNAs were used as a loading control (14) ...
-
bioRxiv - Plant Biology 2022Quote: ... Expression analysis by RT-qPCR was performed using SYBR Green master I (Roche) and the LightCycler® 96 system following a standard protocol (40 cycles ...
-
bioRxiv - Cell Biology 2023Quote: ... RT-qPCR was performed with the LightCycler® 480 Instrument (Roche Life Science) and data were analyzed according to manufacturer’s instruction (Roche LightCycler® 480 software ...
-
bioRxiv - Immunology 2023Quote: ... The RT-qPCR was run on a Roche LightCycler 480 (Roche Diagnostics Ltd) using the conditions outlined in Table 4.
-
bioRxiv - Molecular Biology 2023Quote: ... The RT-qPCR was run on a LightCycler 480 II (Roche Applied Science) using 384 well plates ...
-
bioRxiv - Plant Biology 2023Quote: ... RT-qPCR was performed using LightCycler 480 SYBR Green I Master mix (Roche) and run in a LightCycler 480 System (Roche) ...
-
bioRxiv - Biochemistry 2023Quote: ... The expression of selected genes was measured by RT-qPCR (LightCycler 480; Roche), cDNA was prepared from 1 µg of RNA using QuantiNova Reverse Transcription Kit (Qiagen) ...
-
bioRxiv - Developmental Biology 2023Quote: ... RT qPCR samples were prepared using the KAPPA SYBR R fast (Roche, KK4611). Primer Sequences:
-
bioRxiv - Microbiology 2024Quote: ... RT-qPCR was then performed using SYBR green master mix (Roche, Indianapolis, IN) and a Light Cycler 480 Instrument II (Roche ...
-
bioRxiv - Microbiology 2024Quote: ... and RT-qPCR was performed using SYBR green master mix (Roche, Indianapolis, IN) and a Light Cycler 480 Instrument II (Roche ...
-
bioRxiv - Cancer Biology 2024Quote: ... The RT-qPCR cycling analysis was performed using a LC-480 device (Roche). qBasePlus software 3.2 (www.biogazelle.com ...
-
bioRxiv - Microbiology 2020Quote: ... Cobas PCR Media (Roche); Aptima Specimen Transport Medium (Hologic) ...
-
bioRxiv - Genomics 2022Quote: ... and quantitative PCR (Roche), according to the manufacturers’ instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR Free (KAPA Biosystems). Adaptor ligated DNA was treated with Lambda Exonuclease (NEB ...
-
bioRxiv - Immunology 2023Quote: ... PCR-free (Roche, #KK8503) with KAPA Unique-Dual Indexed (UDI ...
-
bioRxiv - Cell Biology 2020Quote: ... Target regions were amplified by using specific PCR primers (ETV2_F: CACTCGGGATCCGTTACTCC; ETV2_R: GTTCGGAGCAAACGGTGAGA, KDR_F: CAAGCCCTTTGTTGTACTCAATTCT; KDR_R: ATTAATTTTTCAGGGGACAGAGGGA) and KAPA HiFi HotStart PCR kit (KAPA Biosystems, Cat No. KK2601). Sanger sequencing (Genewiz ...
-
bioRxiv - Microbiology 2020Quote: ... Both the pET28a vector and the Rv1630 gene amplification product (1446 bp) were purified using the PCR quick spin kit (Roche) following the manufacturer’s protocol ...