Labshake search
Citations for Roche :
801 - 850 of 3664 citations for hsa mir 635 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Real-time PCR was conducted on Roche Lightcycler 96 Real time PCR system (Roche) with FastStart Essential DNA Green Master (Roche ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The real time PCR program of the quantitative PCR (LightCycler480 II, Roche, Basel, Switzerland) was arranged as follows ...
-
bioRxiv - Pathology 2023Quote: Quantitative PCR (qPCR) was performed using the Quantitect SYBR green PCR Master mix (Roche) with 10 ng of DNA and 0.5 μM primers in a final volume of 10 μl ...
-
bioRxiv - Microbiology 2024Quote: ... and 8 to 10 PCR cycles with the KAPA HiFi PCR kit (Kapa Biosystems) were used for amplification ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 0.25 μM gene-specific primers and 5 μl LightCycler 480 SYBR Green I Master (Roche) on a Roche LightCycler 480 II real-time PCR System according to the manufacturer’s instructions ...
-
bioRxiv - Zoology 2020Quote: ... 0.18 μM of each primer and 0.04 mg of Bovine Serum Albumin Fraction V (Roche), with the following thermal protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA was amplified using gene-specific primers and FastStart Essential DNA Green Master (Roche, 06402712001). Cq values of non-housekeeping genes were normalized to RHOA or b-ACTIN expression ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.5 µM of each primer and 2x KAPA HiFi HotStart ReadyMix (KAPA Biosystems, Wilmington, MA). Each 16S rRNA gene amplicon was purified using the AMPure XP reagent (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR reactions (0.5 μl cDNA, 0.2 μM each primer, SYBR green Master Mix (Kapa biosystems) were performed on a Roche LightCycler 480 Real-Time PCR detection system ...
-
bioRxiv - Cell Biology 2022Quote: ... Intron-spanning primers were designed using the Universal Probe Library (UPL) Assay design centre (Roche). Primer sequences and UPL probes were total SNCA F-tgggcaagaatgaagaaggagc ...
-
bioRxiv - Genomics 2022Quote: ... to assess their size distribution and quantified by qPCR with adapter-specific primers (Kapa Biosystems). Libraries were pooled together based on expected final coverage and sequenced across multiple flow cell lanes to reduce the effect of lane-to-lane variations in yield ...
-
bioRxiv - Immunology 2022Quote: ... RNA concentrations were measured and cDNA was synthesized using random primers (Roche cat. no. 11034731001) and M-MLV reverse transcriptase (Invitrogen cat ...
-
bioRxiv - Systems Biology 2020Quote: ... cDNA was amplified using gene-specific primers and FastStart Essential DNA Green Master (Roche, 06402712001). RHOA expression was used as a housekeeping gene for the normalization of non-housekeeping gene expression ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... qPCR was performed using primers listed below with KAPA Sybr green master mix (Kapa biosystems) on ViiA7 Real-time pcr system (ABI) ...
-
bioRxiv - Cell Biology 2021Quote: ... The TaqMan primer sequences and associated universal probes were generated using ProbeFinder (version 2.53, Roche). The primers themselves were ordered from IDT ...
-
bioRxiv - Immunology 2020Quote: ... using V gene-specific primers 18 and KAPA Biosystems (KAPA HiFi HotStart, Roche, Basel, Switzerland). The PCR conditions were as follows ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA was reverse transcribed using a mixture of oligo dT and random hexamer primers (Roche). Quantification was performed on a Light Cycler 480 using SYBR Green (Roche) ...
-
bioRxiv - Immunology 2023Quote: ... and specific primers (tnf fwd TGTCTTTGAGATCCATGCCGT; tnf rev TCAAAATTCGAGTGACAAGCCTG) were used on LightCycler 480 (Roche). The reactions were performed in triplicates and the results were analyzed with qbase+ software ...
-
bioRxiv - Neuroscience 2023Quote: ... Reverse primers included a promoter for in vitro transcription using SP6 RNA polymerase (Roche RPOLSP6RO) with incorporation of UTP-digoxigenin (Roche 11093274910) ...
-
bioRxiv - Genomics 2023Quote: ... We then build libraries using customized NextSeq primers and Kapa HiFi HotStart ReadyMix (Roche, 07958927001). Libraries were sequenced on an Illumina HiSeq 4000 with paired-end reads of 50 bases.
-
bioRxiv - Neuroscience 2023Quote: ... These primers were used in reactions with LightCycler® 480 SYBR Green I Master (Roche).
-
bioRxiv - Neuroscience 2023Quote: ... These primers were used in reactions with LightCycler® 480 SYBR Green I Master (Roche).
-
bioRxiv - Synthetic Biology 2024Quote: ... was amplified using F3 and R3 primers (Supp. Table 2) and KAPA-Hifi polymerase (Roche). Following a 1X SPRIselect bead DNA cleanup (Beckman Coulter) ...
-
bioRxiv - Cancer Biology 2024Quote: ... cDNA was amplified using gene-specific primers and FastStart Essential DNA Green Master (Roche #06402712001). Cq values of genes of interest were normalized to housekeeping gene RHOA expression.
-
bioRxiv - Immunology 2021Quote: ... All reactions were carried out in a LightCycler 96 System and the fluorescence threshold limit of the probe was automatically set by LightCycler software (Roche). The results were represented as the ΔCt between ZIKV and RNAase P amplification.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The qPCR reactions were set up in 20 μL using LightCycler® 480 SYBR Green I Master 2x (Roche, Germany), 300 nM of oligonucleotides and 1:10 dilutions of each cDNA with three replicates per sample ...
-
bioRxiv - Genetics 2021Quote: ... and quantitative PCR (KAPA Biosystems), according to the manufacturers’ instructions ...
-
bioRxiv - Genomics 2019Quote: ... and quantitative PCR (KAPA Biosystems). The libraries were clustered on 2 lanes of a flowcell then loaded on the Illumina HiSeq instrument according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... and quantitative PCR (Kapa Biosystems), according to the manufacturers’ instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... and quantitative PCR (Kapa Biosystems), according to the manufacturers’ instructions ...
-
bioRxiv - Genomics 2021Quote: ... and quantitative PCR (KAPA Biosystems).
-
bioRxiv - Genomics 2021Quote: ... and quantitative PCR (KAPA Biosystems).
-
bioRxiv - Genetics 2020Quote: ... and quantitative PCR (KAPA Biosystems), according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... and quantitative PCR (KAPA Biosystems), according to the manufacturers’ instructions ...
-
bioRxiv - Genetics 2020Quote: ... and quantitative PCR (KAPA Biosystems), according to the manufacturers’ instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... and quantitative PCR (KAPA Biosystems), according to the manufacturers’ instructions.
-
bioRxiv - Cell Biology 2019Quote: ... The shotgun genomic libraries were prepared with the Hyper Library construction kit from Kapa Biosystems with no PCR amplification (Roche). The libraries were quantitated by qPCR and sequenced on one lane for 151 cycles from each end of the fragments on a HiSeq 4000 using a HiSeq 4000 sequencing kit version 1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... purified (PCR cleanup kit, Roche) and transcribed (SP6 mMessage mMachine Kit Ambion) ...
-
bioRxiv - Neuroscience 2019Quote: ... and quantitative PCR (KAPA Biosystems), according to the manufacturers’ instructions ...
-
bioRxiv - Genetics 2021Quote: ... and quantitative PCR (KAPA Biosystems), according to the manufacturers’ instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... and quantitative PCR (KAPA Biosystems), according to the manufacturers’ instructions ...
-
bioRxiv - Genetics 2019Quote: ... and quantitative PCR (KAPA Biosystems), performed according to the manufacturers’ instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... and quantitative PCR (Kapa Biosystems). Libraries were pooled and sequenced 75bp single end on the NextSeq (Illumina ...
-
bioRxiv - Systems Biology 2022Quote: ... and quantitative PCR (KAPA Biosystems), according to the manufacturer’s instructions.
-
bioRxiv - Systems Biology 2022Quote: ... and quantitative PCR (KAPA Biosystems), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... and q-PCR (Roche, KK4835), and sequenced by Illumina NovaSeq 6000.
-
bioRxiv - Molecular Biology 2023Quote: ... and quantitative PCR (KAPA Biosystems) method were used to quantify each library before multiplexing and the distribution of reads lengths were measured by the Agilent Tapestation 4200 (Agilent Technologies) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and quantitative PCR (KAPA biosystems). Library loading ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and quantitative PCR (KAPA Biosystems). The sequencing library was clustered on one lane of a flowcell and loaded on the Illumina HiSeq instrument (4000 or equivalent ...
-
bioRxiv - Cell Biology 2024Quote: ... and quantitative PCR (KAPA Biosystems). Barcoded libraries were then pooled and sequenced on the HiSeq2000 (Illumina ...