Labshake search
Citations for Roche :
6601 - 6650 of 9754 citations for Monoisodecyl Phthalate 100 Ug Ml In Mtbe Unlabeled Mono 3 7 Dimethyl 1 Octyl Phthalate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... 1× cOmplete mini EDTA-free protease inhibitor cocktail (Roche), 1% Nonidet P-40 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 1 EDTA-free complete protease inhibitor tablet (Roche). The concentration of protein lysates was measure by Qubit assay (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1% deoxycholate) and 5% protease inhibitor cocktail (Roche, Germany). Whole cell extracts were incubated at 4°C for 30 min on a shaker ...
-
bioRxiv - Neuroscience 2021Quote: ... After 1 hour in Western blocking reagent (Roche Diagnostics), membranes were incubated overnight with primary antibodies ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 mM EDTA) supplemented with protease inhibitors (Roche, 11836170001). Protein concentration was determined by BCA assay (Pierce ...
-
bioRxiv - Cell Biology 2021Quote: ... wherein 1× KAPA HiFi HS Ready Mix (KAPA Biosystems) and 0.8 µM 1st PCR primer were included in a 25 μL reaction volume ...
-
bioRxiv - Cell Biology 2020Quote: ... and 1:50 cOmplete proteinase inhibitor cocktail mix (Roche)) on ice for 10 min ...
-
bioRxiv - Cell Biology 2020Quote: ... rat anti-HA (3F10; Roche Diagnostics, 1:1,000 dilution), mouse antiConnectin [C1.427 ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 mM Na3VO4 and protease inhibitor cocktail (Roche, Germany). After centrifugation at 16,000xg for 10 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... SYBR Green 1 Master (Cat# 4887352001, Roche Life science) was used to compare gene expression changes in VPRBP ...
-
bioRxiv - Immunology 2020Quote: ... 1 unit of AmpliTaq DNA polymerase (Roche Applied Science), 200 μM dNTP ...
-
bioRxiv - Molecular Biology 2021Quote: ... the membranes were transferred onto 1× blocking buffer (Roche) and incubated at room temperature for 2-3 h ...
-
bioRxiv - Immunology 2021Quote: ... 20 µg.mL-1 of protease inhibitor cocktail (4693159001, Roche)] (10 mL per 1 L original culture) ...
-
bioRxiv - Immunology 2020Quote: ... 1 mM PMSF and protease inhibitor mixture (Complete, Roche)) ...
-
bioRxiv - Developmental Biology 2021Quote: ... sheep anti-digoxygenin-AP fab fragment 1:4000 (Roche). Alexa Fluor®-conjugated secondary antibodies were from Jackson Immuno Research ...
-
bioRxiv - Genomics 2021Quote: ... 1 U KAPA HiFi HotStart DNA Polymerase (KAPA Biosystems) in 1× HiFi Fidelity Buffer ...
-
bioRxiv - Genetics 2020Quote: ... 10 min DAPI staining (1:5000 in PBS; Roche) and 2 washes with 1xTBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 mM DTT) supplemented with protease inhibitors (cOmplete, Roche) and lysed by sonication ...
-
bioRxiv - Molecular Biology 2022Quote: ... rat-anti-HA (1:1000 for IB; Roche, ROAHAHA), rabbit anti-RECQL5 (1:1000 for IB ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1% NP40) supplemented with protease and phosphatase inhibitors (Roche). Equal amounts of cell lysates were incubated with anti-myc (Cell Signaling Technology ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 tablet of Complete Inhibitor cocktail EDTA Free (Roche) per 500 mL) ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 tablet of Complete Inhibitor cocktail EDTA Free (Roche) per 50 mL ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 tablet of Complete Inhibitor cocktail EDTA Free (Roche) per 500 mL) ...
-
bioRxiv - Biophysics 2022Quote: ... 1× protease inhibitor cocktail (Roche, complete mini-EDTA free), and 1× phosphatase inhibitor cocktail (Roche ...
-
bioRxiv - Biophysics 2022Quote: ... 0.5% NP40 (1 tablet of protease inhibitor (Roche, 11836170001) per 5 mL of buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 mM PMSF and cOmplete protease inhibitor (Roche Diagnostics)) and lysed using glass beads [67] ...
-
bioRxiv - Cell Biology 2022Quote: ... Na Deoxycholate 1%) supplemented with protease inhibitor cocktail (Roche) and PMSF (1mM) ...
-
bioRxiv - Genomics 2022Quote: ... 1 x EDTA-free protease inhibitor cocktail (cOmplete, Roche), 1 μg anti-Flag antibody (clone M2 ...
-
bioRxiv - Plant Biology 2022Quote: ... 1 cOmpleteTM EDTA-free protease inhibitor cocktail tablet (Roche) per 50 ml buffer) ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-α2δ-1 Abs (polyclonal, Roche, Cat # C5105) at 1:1000 or with mouse anti-GAPDH (1:25;000 ...
-
bioRxiv - Neuroscience 2022Quote: ... and 1 cOmpleteTM Protease Inhibitor tablet (Roche, # SKU 11836170001). After homogenization ...
-
bioRxiv - Microbiology 2022Quote: ... containing 1 μL of Anti-digoxigenin-AP conjugate (Roche) at room temperature for 30 min ...
-
bioRxiv - Systems Biology 2022Quote: ... and 1 % IGEPAL/NP-40 supplemented with PhosSTOP (Roche) and cOmplete ...
-
bioRxiv - Immunology 2024Quote: ... this contained 1× KAPA HiFi master mix (Roche, #KK2601), 0.5 μM Smart-seq3 forward primer (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATTGCGCAATG ...
-
bioRxiv - Neuroscience 2022Quote: ... 1% NP-40 with protease and phosphatase inhibitors (Roche). DRG were further lysate by sonicated (Vibra-Cell™ ...
-
bioRxiv - Cell Biology 2022Quote: ... Anti-DIG AP antibody (Roche, Bâle, Switzerland, 1:4000) was added in fresh blocking solution and incubated at 4 °C overnight ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 mM Na3VO4) supplemented with complete protease inhibitors (Roche) and the collected supernatant was used for western blotting ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-HA (rat monoclonal 3F10, Roche #11867431001, 1:5000), anti-TFR (monoclonal H68.4 ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 mM DTT and 1 × cOmplete protease inhibitors (Roche) and sonicated for 15 minutes total time (10s on/20s off ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1 tablet of Complete Mini EDTA-free (11836153001, Roche). The embryos in CDS were flash frozen in liquid nitrogen and samples were stored at -80 °C until they were genotyped and could be combined according to their genotype for further usage ...
-
bioRxiv - Biochemistry 2024Quote: ... EDTA-free protease inhibitor pellet (1 capsule/ 50ml, Roche)) and lysed by a cell disruptor ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse anti-GFP (Roche, 11814460001; 1:10,000 for WB), mouse anti-α-tubulin (Cell Signaling Technology ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with 5 mM type 1 collagen (Roche Diagnostics) to allow spheroid formation and seeded onto the ULA plates at a concentration of 5 × 103 cells per well ...
-
bioRxiv - Cancer Biology 2024Quote: ... with antigen retrieval using Cell Conditioning 1 (CC1, Roche) for 48 minutes and primary antibody incubation for 60 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... rat anti-HA (1:500; Roche, cat no:423001).
-
bioRxiv - Neuroscience 2024Quote: ... rehydration and permeabilization steps (1:3000 Proteinase K (Roche) in PBS-DEPC ...
-
bioRxiv - Neuroscience 2023Quote: ... sheep anti-Digoxigenin-POD (Roche Applied Science; 1:2,000), and sheep anti-Fluorescein-POD (Roche Applied Science ...
-
bioRxiv - Cell Biology 2024Quote: ... or 1/5th volume of anti-GFP antibody (Roche) and 50μl of 0.1M Na-phosphate with gentle agitation for 30min at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... 1:50 protease inhibitor (Complete Tablets EASYpack; 04693116001; Roche), 1:100 Phenylmethylsulfonyl fluoride (PMSF) ...
-
bioRxiv - Cell Biology 2024Quote: ... and 1 mM phenylmethylsulfonyl fluoride (PMSF) (Roche, Cat # 10837091001). The lysate was passed 10 times through a 25-gauge needle ...