Labshake search
Citations for Roche :
6651 - 6700 of 9754 citations for Monoisodecyl Phthalate 100 Ug Ml In Mtbe Unlabeled Mono 3 7 Dimethyl 1 Octyl Phthalate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... 1 mM PMSF and Complete protease inhibitor cocktail (Roche) at 4°C ...
-
bioRxiv - Neuroscience 2024Quote: ... 1 mM PMSF and Complete protease inhibitor cocktail (Roche)] ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1 tablet of Complete Mini EDTA-free (11836153001, Roche). The embryos in CDS were flash frozen in liquid nitrogen and samples were stored at -80 °C until they were genotyped and could be combined according to their genotype for further usage ...
-
bioRxiv - Cell Biology 2023Quote: ... 1:50 protease inhibitor (Complete Tablets EASYpack; 04693116001; Roche), 1:100 Phenylmethylsulfonyl fluoride (PMSF) ...
-
bioRxiv - Cell Biology 2024Quote: ... and 1 mM phenylmethylsulfonyl fluoride (PMSF) (Roche, Cat # 10837091001). The lysate was passed 10 times through a 25-gauge needle ...
-
bioRxiv - Cell Biology 2024Quote: ... or 1/5th volume of anti-GFP antibody (Roche) and 50μl of 0.1M Na-phosphate with gentle agitation for 30min at room temperature ...
-
bioRxiv - Immunology 2024Quote: ... this contained 1× KAPA HiFi master mix (Roche, #KK2601), 0.5 μM Smart-seq3 forward primer (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATTGCGCAATG ...
-
bioRxiv - Biochemistry 2023Quote: ... Following antibody incubation (anti-GFP, 1:1000, Roche #118144600001), membranes were developed in ECL and imaged using the Chemidoc imaging system (Bio-Rad) ...
-
bioRxiv - Biochemistry 2023Quote: ... in 1× HiFi reaction buffer with MgCl2 (05917131103, Roche) were mixed with either 5’ sg RNA or 3’ sgRNA forward primer targeting the OvoA gene ...
-
bioRxiv - Biochemistry 2024Quote: ... EDTA-free protease inhibitor pellet (1 capsule/ 50ml, Roche)) and lysed by a cell disruptor ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse anti-GFP (Roche, 11814460001; 1:10,000 for WB), mouse anti-α-tubulin (Cell Signaling Technology ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with 5 mM type 1 collagen (Roche Diagnostics) to allow spheroid formation and seeded onto the ULA plates at a concentration of 5 × 103 cells per well ...
-
bioRxiv - Cell Biology 2023Quote: ... and 1% NP-40) containing 1x complete Mini (Roche) and 1x PhosSTOP (Roche) ...
-
bioRxiv - Biochemistry 2024Quote: ... and 1 × phosphatase inhibitor (PhosSTOP, 04906837001, Roche, Basel, Switzerland).
-
bioRxiv - Microbiology 2023Quote: ... 1% DDM and EDTA-free protease inhibitor cocktails (ROCHE)) and incubated for 30min at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... and 1:8000 secondary anti-DIG-PO antibodies (Roche) were added ...
-
bioRxiv - Developmental Biology 2022Quote: ... Anti-DIG-POD (Roche Cat. N: 11207733910, 1:500) and Anti-FITC-POD (Roche Cat ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 mM NaF and protease inhibitor cocktail (Roche, 04693132001). After centrifuge at 4 ℃ ...
-
bioRxiv - Microbiology 2023Quote: ... before application of Anti-His6-Peroxidase (Roche, 1:1000) in 5% (v/w ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 tablet of EDTA-free protease inhibitor tablet (Roche), and 1 mM phenylmethylsulfonyl fluoride (PMSF) ...
-
bioRxiv - Neuroscience 2023Quote: ... Nuclei were counterstained with DAPI solution (1:10, Roche). After washing ...
-
bioRxiv - Plant Biology 2023Quote: ... or GFP (diluted 1:1000, catalog no. 11814460001, Roche). Alkaline phosphatase conjugated anti-rabbit ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated with 1× blocking reagent (Roche; 11096176001) for 2 h at RT ...
-
bioRxiv - Biochemistry 2022Quote: ... and 1 tablet of protease inhibitor (EDTA free, Roche). Resuspended cells were subjected to Nitrogen cavitation (Simpson ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 10 μL WST-1 (Roche, Sigma-Aldrich, USA) for 1 hour at 37° C in a humidified incubator with 5% CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... Mouse anti-GFP antibody (1:200, Roche, # 11814460001, Germany), TRITC-conjugated goat anti-rat antibody (1:200 ...
-
bioRxiv - Microbiology 2023Quote: ... 1% NP-40 and 1x protease inhibitors (Roche # 4693159001), followed by centrifugation at 1000 x g at 4° C ...
-
bioRxiv - Genetics 2023Quote: ... 1:1000 anti-GFP antibody (Roche, # 11814460001, RRID: AB_390913) and 1:5000 goat anti-mouse IgG-HRP (Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 x cOmplete protease inhibitor cocktail without EDTA (Roche), and 1 µM Cmd1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 mM EDTA with protease and phosphatase inhibitors (Roche)) was added to dissected and snap-frozen tissues at a ratio of 6 μL/mg of tissue ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 mM DTT and Pierce® Protease Inhibitor (Roche). Thereafter ...
-
bioRxiv - Microbiology 2023Quote: ... and 1 tablet “cOmplete” EDTA-free protease inhibitor (Roche) per 50 mL) ...
-
bioRxiv - Cancer Biology 2023Quote: ... supplemented with 1× protease and phosphatase inhibitor cocktails (Roche). Protein concentrations were obtained using the BCA Protein Assay Kit (Pierce ...
-
bioRxiv - Biochemistry 2023Quote: ... 1× cOmplete mini EDTA-free protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Genetics 2023Quote: ... 1 mM EDTA) with complete protease inhibitors (PI, Roche) at 4ºC for 30 min ...
-
bioRxiv - Microbiology 2023Quote: ... and labeled with anti-HA (1:1000, 1hr; Roche). HA-tagged CDPK1 in the cWT and cMut lines was visualized with secondary goat antibodies (1:2000 ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse anti-GFP antibodies (1:500; 11814460001, Roche Diagnostics), anti-Nav1.1 antibodies (1:10,000 ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 mM DTT) with the protease inhibitor mixture (Roche) after treatment by starvation in the HBSS starvation medium with 1 g/l glucose ...
-
bioRxiv - Cell Biology 2023Quote: ... and anti HA antibody (3F10) (1:250 dilution, Roche). Secondary antibodies anti-guinea pig Alexa 647 ...
-
bioRxiv - Cell Biology 2023Quote: ... 1% Nonidet P-40) supplemented with protease inhibitors (Roche). Cell lysates were spun at 13,000 rpm at 4 °C on a table-top centrifuge to remove cell debris ...
-
bioRxiv - Genomics 2023Quote: ... 1 X cOmplete™ protease inhibitor cocktail (Roche, 11697498001), 0.05% Saponin (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... Following antibodies were diluted in 1-5% BSA (Roche): anti-cGAS (Cell Signaling ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 mM Na3 VO4 and protease inhibitors (4693159001, Roche), incubated for 15 min on ice and centrifuged at 17000 x g for 10 min and cleared lysates were collected ...
-
bioRxiv - Biochemistry 2023Quote: ... pH 6.9) supplemented with either 1 mM GTP (Roche), 1 mM GMPPCP (NU-405S ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and 1 cOmplete™ Protease Inhibitor Cocktail tablet (Roche) per 50ml buffer were added immediately prior to use.
-
bioRxiv - Evolutionary Biology 2023Quote: ... alkaline phosphatase-conjugated anti-DIG antibody (1/5,000, Roche) were treated and the alkaline phosphatase activity was detected by 337 μg/ml 4-nitroblue tetrazolium chloride (NBT ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... alkaline phosphatase-conjugated anti-DIG antibody (1/2,000, Roche) and horseradish peroxidase (HRP)-conjugated anti-fluorescein antibody (1/500 ...
-
bioRxiv - Microbiology 2023Quote: ... 1% sodium deoxycholate) containing complete protease inhibitor cocktail (Roche). Cell lysates were prepared for immunoblot by sonication and clarified supernatants were boiled with 2X dissociation buffer (62.5 mM Tris-HCl [pH 6.8] ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 72 h using WST-1 reagent from Roche Applied Science (Indianapolis ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 mM EDTA) with protease and phosphatase inhibitors (Roche) and protein levels were measured with the Qubit Protein Broad Range (BR ...