Labshake search
Citations for Roche :
5901 - 5950 of 7005 citations for Mouse Cell Surface Hyaluronidase CEMIP2 ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: One million cells were initially lysed in 0.5% CHAPS (3-cholamidopropyl dimethylammonio 1-propanesulfonate) (Roche; #10810118001) in PBS (1x ...
-
bioRxiv - Cell Biology 2024Quote: B16-F1 cells were transfected with X-tremeGENE™ 9 or X-tremeGENE™ 360 (Roche) following manufacturer’s instructions and media was changed 4-6 hours after transfection.
-
bioRxiv - Developmental Biology 2024Quote: ... Testes were homogenized with cell lysis buffer M (Wako) containing cOmplete,Mini Protease Inhibitor cocktail (Roche). One IP generally contained 20µl protein G beads (Protein G HP SpinTrap ...
-
bioRxiv - Cell Biology 2024Quote: HepG2 cells were directly scraped into RIPA supplemented with protease and phosphatase inhibitors (Roche Molecular, #04906845001). For spheroids ...
-
bioRxiv - Cancer Biology 2021Quote: ... size and concentration of cDNA libraries were checked using the Standard Sensitivity NGS kit Fragment Analyzer and qPCR (ROCHE Light Cycler 480). Libraries were sequenced using an Illumina Hiseq 2500 sequencer as single-end 125 base reads ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 µg of total RNA was used to generate libraries using of stranded poly(A) mRNA-Seq library with the KAPA stranded mRNA Library prep kit (KAPA Biosystems, KK8421). Libraries concentration was quantified with Qubit dsDNA HS (High Sensitivity ...
-
bioRxiv - Developmental Biology 2021Quote: ... One microgram of total RNA was reverse transcribed to cDNA using a Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics, Tokyo Japan) using an anchored-oligo(dT)18 primer and random hexamer primer ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Digoxigenin (DIG)- and biotin-labelled antisense probes of target IRs were transcribed from linearized pCS2+ vectors with the coding region of the corresponding receptors using the T7 RNA transcription kit (Roche, Mannheim, Germany). Labelled probes were subsequently fragmented to an average length of about 800 bp by incubation in sodium carbonate buffer (80 mM NaHCO3 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The digoxigenin (DIG)-labeled sense or antisense RNA probe for full-length Emi2 was synthesized with a DIG-RNA-labeling kit (Roche Molecular Biochemicals). No signal was detected with sense probes ...
-
bioRxiv - Developmental Biology 2021Quote: ... The DIG-labeled 3’UTR of Emi2 and cyclin B1 RNA probes were synthesized with a DIG-RNA-labeling kit (Roche Molecular Biochemicals). Two μg of probes was incubated with purified Flag-tagged proteins for 15 min ...
-
bioRxiv - Physiology 2022Quote: ... was performed on the cDNA using the Sybr green method of quantification on a Roche Lightcycler 480 using a SYBR FAST quantitative PCR kit (Kapa Biosystems; KK4611). Gene expression was analyzed for each sample in triplicate using the forward and reverse primers indicated on Table 1 ...
-
bioRxiv - Neuroscience 2022Quote: ... and PlxnA4 expression levels were measured by qRT-PCR reaction using KAPA SYBR FAST ABI prism qPCR kit (Kapa Biosystems, catalog #KK4605). Primers (5’3’ ...
-
bioRxiv - Genomics 2020Quote: ... a total of 100 ng DNA from each bacterial strain was used according to KAPA Hyper Prep kit (KAPA Biosystems, MA, USA) at the Georgia Genomics and Bioinformatics Core (GGBC) ...
-
bioRxiv - Genomics 2020Quote: Each of the 10 plate libraries was quality assessed on an Agilent Bioanalyzer 2100 High Sensitivity chip and quantified by qPCR using the Illumina Kapa Library Quantification Kit (Roche, Cat. #KK4824). The libraries were then normalized to a concentration of 4 nM and pooled for sequencing ...
-
bioRxiv - Genomics 2020Quote: ... Hybridization of the digoxegenin (DIG)-labelled 31bp oligonucleotide probe and detection was carried out following the DIG High-Prime Labelling and Detection Starter Kit (Roche SKU 11745832910).
-
bioRxiv - Microbiology 2020Quote: ... Total RNA was collected 96 hours post-infection (hpi) and RNA was extracted with the High Pure RNA Isolation kit (Roche, cat#11828665001), according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Libraries were subsequently dual indexed and amplified for 15 cycles using a KAPA HiFi HotStart PCR kit (Kapa Biosystems, Wilmington, Ma. USA) in 50-µl reactions following the manufacturer’s guidelines ...
-
bioRxiv - Evolutionary Biology 2021Quote: Two-color in the fluorescence in situ hybridization experiment was performed following the instructions of DIG RNA Labeling Kit (Roche, Mannheim, Germany). When synthesizing probe ...
-
bioRxiv - Genomics 2020Quote: ... Chemiluminescent detection of anti-DIG was performed using CDP-Star reagents from the DIG Northern Starter Kit (Roche # 12 039 672 910). Densitometry was performed in ImageJ.
-
bioRxiv - Immunology 2021Quote: ... and high density LP (HDL) fractions were determined by enzymatic colorimetric kits (Labtest do Brasil) in a Cobas automatic analyzer (F Hoffman-La Roche, Basel, Switzerland).
-
bioRxiv - Plant Biology 2020Quote: Sequencing libraries were prepared following (Meyer and Kircher, 2010) and using the SeqCap EZ library preparation kit (Roche Nimblegen, Madison, WI, USA). Briefly ...
-
bioRxiv - Microbiology 2020Quote: ... The concentration of the pooled samples was determined using the Kapa Biosystems library quantification kit for Illumina platforms (Kapa Biosystems, MA, USA). Agilent Bioanalyzer high- sensitivity DNA analysis kit (Agilent CA ...
-
bioRxiv - Bioengineering 2021Quote: ... Total RNA of 1 μg from each sample was reverse transcribed with random hexamers using Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... of these dilutions were used to prepare the reaction mixes for the real-time qRT-PCR using the KAPA SYBR FAST One-Step Universal kit (Roche, Basel, Switzerland) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... washing and detection were performed according to instructions of the DIG-High Prime DNA Labeling and Detection Starter Kit II (Roche, Mannheim, Germany).
-
bioRxiv - Microbiology 2020Quote: ... PCR amplification of 16S rRNA genes was conducted using the KAPA2G™ Robust HotStart ReadyMix PCR Kit (Kapa Biosystems, Wilmington, MA, USA) in a total volume of 25 μl containing inner primer pairs (50 nM each ...
-
bioRxiv - Plant Biology 2020Quote: ... antisense RNA probes were generated using a DIG-labeling kit and the resulting probes hydrolyzed as previously described (Roche Diagnostics, IN, USA) (36) ...
-
bioRxiv - Microbiology 2020Quote: ... Tissues were then processed for immunohistochemistry using the Discovery Ultra automated processor (Ventana Medical Systems) with a ChromoMap DAB kit (Roche Tissue Diagnostics).
-
bioRxiv - Plant Biology 2021Quote: ... and quantified by RT-qPCR in a Bio-Rad CFX384 Touch detection system using the KAPPA KK4824 kit (Kapa Biosystems, Wilmington, USA). Two 150-bp single-end sequencing libraries were prepared using the NextSeq 500/550 High Output Kit (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... The libraries were quantified using KAPA Library Quantification kits for Illumina Sequencing platforms according to the qPCR Quantification Protocol Guide (KAPA BIOSYSTEMS, #KK4854). Finally ...
-
bioRxiv - Neuroscience 2020Quote: Total genomic DNA was extracted from myoblasts from all participating patients using a High Pure PCR Template Preparation Kit (Roche, Basel, Switzerland).
-
bioRxiv - Microbiology 2021Quote: ... The concentration of the pooled samples was determined using the Kapa Biosystems library quantification kit for Illumina platforms (Kapa Biosystems, MA, USA). Agilent Bioanalyzer high sensitivity DNA analysis kit (Agilent CA ...
-
bioRxiv - Neuroscience 2020Quote: ... One microgram of the total RNA was reverse-transcribed using the Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics, Florham Park, NJ). qPCR was performed using iTaq Universal SYBR Green Supermix (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... Southern blot was performed using the DIG High Prime DNA Labeling and Detection Starter kit I according to the manufacturer’s instructions (Roche Diagnostics, Mannheim, Germany). The specific sequence was amplified from Hph gene using primer pairs (Supplemental Table S2) ...
-
bioRxiv - Immunology 2020Quote: ... generation of TCR libraries and generation of amplicons for deep sequencing were performed using the KAPA HiFi PCR kit with GC buffer (Roche Diagnostics, #07958846001) and custom designed primers (Supplementary Table 6) ...
-
bioRxiv - Plant Biology 2021Quote: ... Target DNA capture was performed as previously described (24) with slight modifications using a SeqCap EZ Hybridisation Wash Kit (Nimblegen/Roche, Madison, USA) and Dynabeads M-270 Streptavidin (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2021Quote: ... The sheared DNA fragments were end-repaired and deoxyadenosine-tailed in a 60 µL volume with 3 µL End Repair & A-Tailing Enzyme Mix and 7 µL End Repair & A-Tailing Buffer using a KAPA Hyper Prep Kit (KAPA Biosystems, USA) according to the manufacturer instructions (20°C 30 min ...
-
bioRxiv - Microbiology 2021Quote: ... PCR amplification of the 16S rRNA gene was performed using the KAPA2G™ Robust HotStart ReadyMix PCR Kit (Kapa Biosystems, MA, USA) with an inner primer pair (50 nM for each ...
-
bioRxiv - Cell Biology 2021Quote: ... qPCR was carried out on an QuantStudio™ 6 Flex Real-Time PCR System using a SYBR green-based real-time kit (Kapa Biosystems). The RNA polymerase II subunit ama-1 was used as the house-keeping control ...
-
bioRxiv - Molecular Biology 2022Quote: ... negative and positive samples contained an equivalent volume of HBsAg-specific diluent ([HBSAGQ2 Dil HepB] from the Elecsys HBsAg II quant II immunoassay kit (Roche Diagnostics International) and were used to exclude unknown contamination within the experimental setup and laboratory environment ...
-
bioRxiv - Microbiology 2022Quote: ... 0.2 μL of each primer (100mM stock) (Table SI-4) and 5 μL of 2× KAPA SYBR Fast Universal qPCR kit (KAPA Biosystems, USA). Samples were cycled (40 cycles ...
-
bioRxiv - Plant Biology 2022Quote: ... The primers designated ‘forward’ (GCCTTTTCAGCAAGATGCCG) and ‘reverse’ (GTACTCCCTCCGCTCCAAAAT) were used to perform PCR amplifications with the Kapa HiFi HotStart PCR kit (Kapa Biosystems, Roche). The reactions were performed in a SimpliAmp Thermal Cycler (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2022Quote: ... According to the manufacturer’s protocol for Southern blot hybridization and detection digoxigenin-labeled hybridization probes (DIG DNA Labeling and Detection Kit, Roche Applied Science, 11175033910) were used ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were scraped and lysed in lysis buffer of Pierce Crosslink IP Kit (Thermo/Pierce) with complete protease inhibitor cocktail tablet (Roche Applied Sciences). Cell lysates were incubated overnight at 4°C with anti-Myc-sepharose made with anti-Myc antibody (Cell signaling ...
-
SARS-CoV-2 Point Mutation and Deletion Spectra, and Their Association with Different Disease OutcomebioRxiv - Microbiology 2022Quote: ... Each region was amplified from 5 μl of the RNA preparation by RT-PCR using Transcriptor One Step RT-PCR kit (Roche Applied Science). To perform the RT-PCR ...
-
bioRxiv - Pathology 2022Quote: ... was isolated from either the IFP or replacement tissue that remained in formalin-fixed paraffin-embedded blocks following acquisition of adequate sections for histopathology and immunohistochemistry (IHC) using a commercially available kit specifically designed for such (Roche, Basel, Switzerland). A custom set of guinea pig-specific probes were designed and manufactured by NanoString Technologies (Seattle ...
-
bioRxiv - Microbiology 2022Quote: ... by the capillary method and hybridised with digoxigenin-labelled blaOXA- 58 and blaNDM-1-specific probes with an NBT/BCIP colour detection kit (Roche, Mannheim, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Final libraries were checked for quality and quantity using the Agilent TapeStation system and qPCR using a KAPA Library Quantification Kit for Illumina sequencing platforms (Kapa Biosystems, Roche). Sequencing was conducted in the Illumina NovaSeq platform (Illumina ...
-
bioRxiv - Plant Biology 2021Quote: Gene expression analysis via RT-qPCR was performed using a LightCycler480 instrument and LightCycler480 SYBR Green Master Kit reagents (Roche, Indiana, IN). Relative gene expression levels were determined using a standard curve method ...
-
bioRxiv - Plant Biology 2021Quote: ... qRT-PCR was performed as described in Han et al., 2018 (Han et al., 2018) using KAPA SYBR® FAST qPCR Kit Master Mix on LightCycler® 96 instrument (Roche). Relative expression was calculated by dividing ACTIN2 gene expression over the specific-gene expression and the fold change was calculated by dividing estradiol expression over DMSO (mock ...