Labshake search
Citations for Agilent :
1251 - 1300 of 1560 citations for Carboxypeptidase Y from Baker's Yeast since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... CodonPlus-RIL yggh::kan strain was constructed by transferring the yggh::kan cassette from the appropriate K-12 strain of the Keio collection (77) to a BL21(DE3) CodonPlus-RIL strain (Agilent) by phage P1 vir-mediated transduction (78 ...
-
bioRxiv - Biophysics 2023Quote: ... were conducted with an untreated fused silica capillary (50 μm × 40 cm) with an extended light path purchased from Agilent Technologies in pH 9.3 and with 50 mM sodium tetraborate buffer using a CE method at 20kV and 24s injection time.
-
bioRxiv - Cell Biology 2023Quote: ... 1 μM of carbonylcyanide-4-(trifluoromethoxy)-phenylhydrazone (FCCP) (Seahorse XF Cell Energy Phenotype Test Kit from Agilent or Sigma Aldrich), and 1 μM of antimycin A and rotenone (Sigma Aldrich) ...
-
bioRxiv - Cell Biology 2023Quote: Genes of interest were PCR cloned from either cDNA or gDNA of N2 Bristol strain using PfuUltra II Fusion HS DNA polymerase (Agilent). Amplicon was ligated into pSM vector backbone for expression in C ...
-
bioRxiv - Cell Biology 2023Quote: ... exon 2 (splice site: donor and acceptor) and the CDS of hrGFP from the Vitality hrGFP mammalian expression vector pIRES-hrGFP-2a (Stratagene) were added ...
-
bioRxiv - Physiology 2023Quote: Isolated RNA from left ventricles of 21-week-old Nnt+/+ and Nnt-/- mice was analyzed for quality using a Bioanalyzer 2100 (Agilent). Total RNA was depleted from ribosomal RNA ...
-
bioRxiv - Molecular Biology 2023Quote: RNA was extracted from HEK293T cells as described above and RIN determined to be 10 for all samples (Bioanalyzer 6000, Agilent). Libraries were constructed from 800 ng total RNA (NEBNext Multiplex Small RNA library prep set for Illumina ...
-
bioRxiv - Developmental Biology 2023Quote: ... Approximately 300 animal caps from 7 independent experiments were collected and processed for TAP following manufacturer’s instructions (InterPlay Mammalian TAP System, Agilent Technologies). Samples subjected to TAP were sent for identification of proteins by nanoLC/MS/MS to MS Bioworks ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... from these samples (muscle or blood) using Qiagen MagAttract HMW DNA Kit and checked the DNA quality using TapeStation (Agilent), Qubit ...
-
bioRxiv - Biochemistry 2024Quote: The expression vector encoding His-tagged SpNOXDH - aa 181-417 of full-length SpNOX - was obtained from SpNOX by site-directed mutagenesis according to the manufacturer’s protocol (QuikChange® Lightning Site-Directed Mutagenesis Kit, Agilent), using forward primer 5’GTCTGGTCCCGCGTGGCAGTAAAATTAGCTTTCCGTATCTGGG3’ and reverse primer 5’CCCAGATACGGAAAGCTAATTTTACTGCCACGCGGGACCAGAC3’ ...
-
bioRxiv - Systems Biology 2024Quote: ... The calibration status of the machine is monitored constantly and calibration of the ion mobility dimension is performed linearly using at least three ions from Agilent ESI LC/MS tuning mix (m/z ...
-
bioRxiv - Cell Biology 2024Quote: ... goat horseradish peroxidase (HRP) anti-mouse IgG (#P0447; 1:1000) and anti-rabbit IgG (#P0448; 1:1000) were from Dako.
-
bioRxiv - Biochemistry 2024Quote: ... A Zorbax SB-C8 reversed-phase column (5 μm, 2.1 x 50 mm) was obtained from Agilent (Palo Alto, CA). The LC eluent was introduced into the ESI source of the mass spectrometer ...
-
bioRxiv - Plant Biology 2024Quote: ... The quality of the RNA extracted from transformed protoplasts was checked using the Agilent 2100 Bioanalyzer Nano Chip (Agilent, Germany).
-
bioRxiv - Immunology 2024Quote: ... From this construct, CDC42 point mutants (R186C, C188Y, Y64C) were obtained by site-directed mutagenesis (Quick change kit, Agilent Technologies). The *192C*24 plasmid was produced by ThermoFisher.
-
bioRxiv - Biochemistry 2024Quote: ... The analytical system comprised of Agilent 1290 Infinity UHPLC system coupled with an Agilent 6460 triple quadrupole (QqQ) mass spectrometer from Agilent Technologies Inc ...
-
bioRxiv - Molecular Biology 2024Quote: ... is a pCEP4-based plasmid that contains the humanized enhanced green fluorescent protein (hrGFP) coding sequence from phrGFP-C (Agilent) under the control of the pCEP4 CMV promoter and SV40 polyadenylation signal (39).
-
bioRxiv - Plant Biology 2024Quote: ... An increase of fluorescent signal from free AMC (λex 365nm; λem 440 nm) was monitored by using BioTek Synergy H1 (Agilent) at room temperature ...
-
bioRxiv - Molecular Biology 2024Quote: ... For phospho-peptide enrichment 200 µg of peptides in 100 µL were subjected to enrichment using the default phospho-peptide enrichment protocol from the AssayMAP Bravo Platform (Agilent). For the enrichment 50 ml of 0.1% formic acid (FA ...
-
bioRxiv - Neuroscience 2024Quote: ... An RNA integrity of above 8 for all samples was confirmed post extraction using the Tapestation RNA ScreenTape from Agilent. 500 ng of total RNAs were used to prepare sequencing libraries using the TruSeq Stranded total RNAs Library Prep Kit (Illumina ...
-
bioRxiv - Microbiology 2024Quote: DNA isolated from samples was assessed for sample quality and DNA fragment size on a TapeStation (Agilent, Santa Clara, CA). DNA libraries for sequencing were prepared using the Illumina DNA Seq protocol (formerly ...
-
bioRxiv - Cancer Biology 2024Quote: The oxygen consumption rates (OCR) and extracellular acidification rates (ECAR) were measured using an XFe96 Seahorse extracellular analyzer from Agilent Technologies Inc ...
-
bioRxiv - Neuroscience 2024Quote: ... Site-directed mutagenesis was either provided by VectorBuilder or performed similar to the Quik-Change Site-Directed mutagenesis kit from Agilent Technologies (Santa Clara ...
-
bioRxiv - Biochemistry 2024Quote: The HAdV5HVR7 vectors (“1st generation” vectors) were obtained by cloning the gene of interest into the pAdEasy-1 plasmid system from Agilent Technologies ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 mM Seahorse XF L-glutamine solution and 1 mM Seahorse XF pyruvate solution (103577-100, 103579-100 and 103578-100, all from Agilent) and cells were kept in a CO2 free incubator for 45 min prior to starting the Cell Mito Stress Test ...
-
bioRxiv - Microbiology 2024Quote: ... quality and size distribution of the libraries with capillary electrophoresis using D1000 ScreenTapestation from Agilent (size range 100-800 bp) (Agilent Technologies ...
-
bioRxiv - Neuroscience 2024Quote: ... Deparaffinization and antigen retrieval was performed in the low pH EnVision FLEX Target Retrieval Solution at 98 °C for 24 minutes in the DAKO PT link from Agilent. Antibodies were diluted in DaVinci Green Diluent (Biocare ...
-
bioRxiv - Biochemistry 2024Quote: ... Subsequent purification through reverse phase High-Performance Liquid Chromatography (HPLC) with a Zorbax Stable Bond 300 C18 column from Agilent using a linear gradient of 10 % - 90 % solvent B over 60 min was done ...
-
bioRxiv - Neuroscience 2024Quote: ... 200 ng of isolated total RNA from each sample was used and the concentration of resulting cDNA library was measured with High Sensitivity DNA chips (Agilent) using a 2100 Bioanalyzer Instrument (Agilent) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and RGMoV were amplified and cloned into the pTRG vector from the BacterioMatch II Two-Hybrid system (Agilent Technologies, USA) using the following procedures ...
-
bioRxiv - Biochemistry 2024Quote: CE-ESI-MS measurements were adapted from previous published works and performed on an Agilent 7100 CE system (Agilent Technologies) coupled to an Agilent G6495C Agilent QQQ mass spectrometer equipped with a commercial Agilent jet stream (AJS ...
-
bioRxiv - Biochemistry 2024Quote: ... OXA-163 and OXA-405 vectors were then generated from pUBYT OXA-48 using QuikChange Lightning site-directed mutagenesis kit (Agilent) (primers listed in Table S5) ...
-
bioRxiv - Biochemistry 2024Quote: ... a custom Agilent Personal Compound Database and Library (PCDL) of target metabolites (glycolytic and tricarboxylic acid cycle intermediates) was created from Agilent METLIN PCDL ...
-
bioRxiv - Neuroscience 2024Quote: ... 200 ng of isolated total RNA from each sample was used and the concentration of resulting cDNA library was measured with High Sensitivity DNA chips (Agilent) using a 2100 Bioanalyzer Instrument (Agilent) ...
-
bioRxiv - Neuroscience 2024Quote: ... 200 ng of isolated total RNA from each sample was used and the concentration of resulting cDNA library was measured with High Sensitivity DNA chips (Agilent) using a 2100 Bioanalyzer Instrument (Agilent) ...
-
bioRxiv - Cell Biology 2024Quote: ... Library QC was performed by measuring the concentration and size of the libraries by using the 4150 Tapestation system from Agilent and Qubit dsDNA HS assay kit (Thermo Fisher Scientific) ...
-
bioRxiv - Bioengineering 2024Quote: ... we washed and cultured BMDMs in the Seahorse XF DMEM medium (pH 7.4) supplemented with 25 mM D-glucose and 4 mM Glutamine (all sourced from Agilent Technologies) for an hour in a non-CO2 incubator at 37 °C ...
-
bioRxiv - Cancer Biology 2024Quote: ... The DIRT domain was deleted from pLenti6-3xHA-MARCHF8 using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent, 200522) and the primers listed in table S2 ...
-
bioRxiv - Biochemistry 2024Quote: ... The mature CXCL17 peptide was eluted from a C18 reverse-phase column (Zorbax 300SB-C8, 9.4 × 250 mm, Agilent Technologies) by an acidic acetonitrile gradient and manually collected ...
-
bioRxiv - Cell Biology 2024Quote: Global phosphopeptide enrichment started from 200 µg peptides using IMAC cartridges (AssayMAP Fe(III)-NTA) on a Bravo Assaymap liquid handler (Agilent). Phosphopeptides were dried in a vacuum centrifuge and dissolved in 20 µl 0.5% TFA/4% ACN prior to injection ...
-
bioRxiv - Biochemistry 2024Quote: ... reaction mixtures were loaded onto a polyacrylamide-coated capillary of 54/46 cm total/effective length with an internal diameter of 50 μm from Agilent and run on a Capel 105 M from Lumex Instrument at 20 °C using -25 kV ...
-
bioRxiv - Biochemistry 2024Quote: ... and P221 was mutated to a leucine residue in the GST-PHRF1RP construct to create GST-PHRF1RP(P221L) using a QuikChange II Site-Directed Mutagenesis Kit from Agilent Technologies ...
-
A gated hydrophobic funnel within BAX binds long-chain alkenals to potentiate pro-apoptotic functionbioRxiv - Cell Biology 2024Quote: ... units) is derived from measured parallel and perpendicular emission intensities (I) and was calculated by the Gen5 software (BioTek/Agilent); Polarization can also be calculated manually using Equation 2 ...
-
bioRxiv - Cell Biology 2024Quote: ... Fluorescence was monitored with excitation and emission filters set at 465 and 590 nm during gradual heating (1 K/min) from 25 °C to 95 °C in a MX3005P real-time PCR instrument (Stratagene). Data was evaluated using MXPro3005 software (Stratagene ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1ug of Hi-C library per sample were hybridized with 120 nucleotide biotinylated RNA probes using the SureSelect kit from Agilent and PCR amplification using the polymerase from the Kapa Hyper Prep Kit ...
-
bioRxiv - Developmental Biology 2024Quote: ... homology arms covering about 1.2kb of sequence around the Ehmt2 stop codon were PCR-amplified from KH2 genomic DNA and cloned into pBluescript (Stratagene) vector together with an FKBP12F36V-2xHA-P2A-NLS-mCherry cassette ...
-
bioRxiv - Plant Biology 2020Quote: ... sucked 500 μl solution from the tube to detect the concentrations of remaining nitrate using High Performance Capillary Electrophoresis System (Agilent Technologies). Then measured the root fresh weights and calculated the nitrate uptake speeds (NO3− (μmol)/root fresh weight (g)/h) ...
-
bioRxiv - Microbiology 2020Quote: ... Ethylene and acetylene gas from the gas phase of the Hungate tubes were determined using a GC (model GC-7890, Agilent Technologies) equipped with a flame ionization detector (FID) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Mutations in genomic DNA from the spleen and liver were detected using the λ Select-cII Mutation Detection System for Big Blue Rodents (Stratagene) as we have done in the past (58).
-
bioRxiv - Cancer Biology 2021Quote: ... was used to synthesize cDNA from 1 ug RNA and Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent Technologies) was used for the Quantitative RT-PCR reactions ...