Labshake search
Citations for Agilent :
1201 - 1250 of 1560 citations for Carboxypeptidase Y from Baker's Yeast since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... desorption of the VOCs from the fiber coating was carried out in the injection port of the GC apparatus (Model 8890; Agilent) at 250°C for 5 min in the splitless mode ...
-
bioRxiv - Cancer Biology 2024Quote: ... One microgram or more of mouse genomic DNA from each sample was analyzed by whole exome sequencing using the SureSelectXT Mouse All Exon kit (Agilent), followed by next generation sequencing using the NovaSeq 6000 S4 flow cell (Illumina ...
-
bioRxiv - Immunology 2023Quote: ... Double-stranded DNA was amplified from cDNA with CMVR-SOSIP-fwd (gtcaccgtcgtcgacgccacc atggaaaccgatacactgct) and CMVR-SOSIP-rev using Herculase II Fusion DNA Polymerases (Agilent) and subcloned into CMVR vector by SalI/BglII digestion and ligation ...
-
bioRxiv - Plant Biology 2024Quote: ... and ion mobility calibration was performed using ESI-L low concentration tune mix bought from Agilent (Santa Clara, CA, USA). The 10 mM sodium formate solution contained 1 M NaOH (250 μL ...
-
bioRxiv - Cell Biology 2024Quote: ... of WRN was amplified by PCR from the pCMV-FlagWRN plasmid or from the pCMV-FlagWRNS1133D mutant The PCR product were subsequently purified and sub-cloned into pGEX4T-1 vector (Stratagene) for subsequent expression in bacteria as GST-fusion proteins ...
-
bioRxiv - Biochemistry 2024Quote: ... The calibrated concentrations of the cleavage product bands (electrogram peak areas) were used to calculate percent cleavage from total plasmid band intensity using TapeStation Analysis software (Agilent).
-
bioRxiv - Biophysics 2024Quote: ... The pBAD30-ClsA (EE) G51A mutant plasmid was generated from the pBAD30- ClsA (EE) template with QuikChange II Site-Directed Mutagenesis Kit (Agilent). Two residues ...
-
bioRxiv - Cell Biology 2023Quote: ... labeled cRNA was prepared from 0.1 micro-g Total RNA using the Low Input Quick Amp Labeling Kit (Agilent Technologies) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... assessed by high-performance liquid chromatography–mass spectrometry (HPLC-MS; mass detector 6120 quadrupole, HPLC-1200; both from Agilent, USA).
-
bioRxiv - Neuroscience 2023Quote: ... FLAG-NBR1 was generated by clone the NBR1 sequence from GFP-NBR1 into pCMV-Tag 2C vector (Agilent Technologies, #211172). pGEX6P was purchased from Millipore Sigma ...
-
bioRxiv - Biochemistry 2023Quote: The gene for Pyrococcus horikoshii (Ph) LeuRS was synthesized by Gene Universal and expressed from pET-11a in BL21-CodonPlus (DE3)-RIPL (Agilent). Cells were grown at 37°C and induced with 300 µM IPTG for 4 hours then harvested and stored overnight at -20°C ...
-
bioRxiv - Plant Biology 2022Quote: For the analysis of the semi-polar extracts a C18 reverse phase column and a UHPLC-ESI-Q-TOF system from Agilent Technologies was used ...
-
bioRxiv - Microbiology 2022Quote: We extracted extracellular metabolites from the seawater matrix using Bond Elut PPL cartridges (1 g/6 ml sized cartridges, Agilent) following the protocol of Dittmar et al ...
-
bioRxiv - Developmental Biology 2023Quote: ... with a KpnI site inserted at the 5’ end of Δ3-1 or Δ3-2 (Quick Change Site-Directed Mutagenesis from Stratagene) using the oligonucleotides Δ3-1-KpnI Fw ...
-
bioRxiv - Developmental Biology 2023Quote: ... 60sal- MUT2 and 60sal-MUT3 were generated from pENTR/D-TOPO-UAS(5x)-60sal(1x) using Pfu polymerase and Quick Change Site-Directed Mutagenesis (Stratagene). Sequences of 6 nucleotides were changed C to A and G to T using the oligonucleotide pairs 60sal- MUT1 Fw and 60sal-MUT1 Rv ...
-
bioRxiv - Microbiology 2023Quote: ... Petri dishes were removed from the anaerobic chamber and UV-irradiated with specific doses (mJ) in a UV Stratalinker 1800 (Stratagene) stored in a 37 °C room ...
-
bioRxiv - Plant Biology 2023Quote: ... desorption of VOCs from the fiber coating was performed in the injection port of the GC apparatus (Model 8890; Agilent), at 250 °C for 5 min ...
-
bioRxiv - Cell Biology 2023Quote: ... was purchased from Jackson ImmunoResearch Laboratories and was used for Western blotting. Affinity-purified rabbit polyclonal anti-human lambda-light chain (cat. A019302-2) was purchased from Dako and was used for Western blotting ...
-
bioRxiv - Developmental Biology 2023Quote: ... directly coupled to the ESI jet stream nebulizer of an Agilent 6530 series ESI-Q-TOF high-resolution mass spectrometer from Agilent Technologies (Waldbronn ...
-
bioRxiv - Cell Biology 2023Quote: The assessment of oxygen consumption rates (OCR) and extracellular acidification rate (ECAR) was conducted using a Seahorse Extracellular Flux (XF)-96 Bioanalyzer from Agilent Technologies ...
-
bioRxiv - Developmental Biology 2023Quote: ... size-selected in the range of 300 bp on a chip from BluePippin (Sage Science) and lastly QC tested on a Bioanalyzer (Agilent). The libraries were sequenced as single-end 50-bp reads on a HiSeq 4000 (Illumina ...
-
bioRxiv - Biophysics 2023Quote: ... derivative encoding two cysteine residues at positions 366 and 511 [constructed from plasmid pGEMD (-Cys)46 by use of site-directed mutagenesis (QuikChange Site-Directed Mutagenesis Kit; Agilent) to replace codons 366 and 511 by a codon encoding cysteine residue] ...
-
bioRxiv - Genetics 2023Quote: The pooled CRISPRi library was constructed by amplification of sgRNA-encoding spacer sequences (Table S6) from a custom pooled oligonucleotide library (SurePrint G7221A, Agilent) followed by ligation into the BsaI-digested MCi plasmid ...
-
bioRxiv - Microbiology 2023Quote: ... All the H2 mutant constructs were subsequently derived from the pEF6-H2R plasmid using a QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent), with mutation accuracy confirmed by sequencing (Genomics Inc. ...
-
bioRxiv - Microbiology 2023Quote: ... All subsequent tH2 mutants expressed in bacteria were derived from pET28a-Smt3-tH2 using a QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... and Seahorse XF Cell Mito Stress Test Kit (catalog number 103015-100, contains 1 each of oligomycin, FCCP, and rotenone/antimycin A.) were all purchased from Agilent Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... dTRCs were extracted from the river and HZ water matrix using a solid phase extraction with Bondesil C18 resin (Agilent). Samples were passed over 8 ml of resin at the rate of 1 ml•min−1 ...
-
bioRxiv - Molecular Biology 2023Quote: cDNA libraries were generated from RNA samples by using Kapa RNA HyperPrep Kit with RiboErase kit with quality assessed by Agilent High Sensitivity D1000 ScreenTape according to the manufacturers’ protocols ...
-
bioRxiv - Microbiology 2023Quote: ... pBS-UGI-flag was constructed by amplifying the UGI and flag sequence from UGI- pFERp44 by PCR and cloning it into the NotI and EcoRI sites of pBluescript II KS(+) (Stratagene). pAAV-UGI was constructed by cloning the entire coding sequence of UGI amplified from pBS-UGI-flag by PCR using the primers shown in S-Table 3 into the EcoRI and BamHI sites of pAAV-ZsGreen1 (TaKaRa).
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... on an Agilent 7890 A GC system equipped with an Agilent 7000 Triple Quad and an Agilent 7693 autosampler (GC-MS/MS) from Agilent Technologies ...
-
bioRxiv - Biochemistry 2022Quote: ... CodonPlus-RIL yggh::kan strain was constructed by transferring the yggh::kan cassette from the appropriate K-12 strain of the Keio collection (77) to a BL21(DE3) CodonPlus-RIL strain (Agilent) by phage P1 vir-mediated transduction (78 ...
-
bioRxiv - Biophysics 2023Quote: ... were conducted with an untreated fused silica capillary (50 μm × 40 cm) with an extended light path purchased from Agilent Technologies in pH 9.3 and with 50 mM sodium tetraborate buffer using a CE method at 20kV and 24s injection time.
-
bioRxiv - Cell Biology 2023Quote: ... 1 μM of carbonylcyanide-4-(trifluoromethoxy)-phenylhydrazone (FCCP) (Seahorse XF Cell Energy Phenotype Test Kit from Agilent or Sigma Aldrich), and 1 μM of antimycin A and rotenone (Sigma Aldrich) ...
-
bioRxiv - Cell Biology 2023Quote: Genes of interest were PCR cloned from either cDNA or gDNA of N2 Bristol strain using PfuUltra II Fusion HS DNA polymerase (Agilent). Amplicon was ligated into pSM vector backbone for expression in C ...
-
bioRxiv - Cell Biology 2023Quote: ... exon 2 (splice site: donor and acceptor) and the CDS of hrGFP from the Vitality hrGFP mammalian expression vector pIRES-hrGFP-2a (Stratagene) were added ...
-
bioRxiv - Physiology 2023Quote: Isolated RNA from left ventricles of 21-week-old Nnt+/+ and Nnt-/- mice was analyzed for quality using a Bioanalyzer 2100 (Agilent). Total RNA was depleted from ribosomal RNA ...
-
bioRxiv - Molecular Biology 2023Quote: RNA was extracted from HEK293T cells as described above and RIN determined to be 10 for all samples (Bioanalyzer 6000, Agilent). Libraries were constructed from 800 ng total RNA (NEBNext Multiplex Small RNA library prep set for Illumina ...
-
bioRxiv - Developmental Biology 2023Quote: ... Approximately 300 animal caps from 7 independent experiments were collected and processed for TAP following manufacturer’s instructions (InterPlay Mammalian TAP System, Agilent Technologies). Samples subjected to TAP were sent for identification of proteins by nanoLC/MS/MS to MS Bioworks ...
-
bioRxiv - Plant Biology 2023Quote: ... the first-strand complementary DNA (cDNA) was synthesized from 1 μg of RNA using oligo (dT) primers with Reverse Transcriptase (Agilent). Quantitative reverse transcription polymerase chain reaction (qRT-PCR ...
-
bioRxiv - Systems Biology 2023Quote: ... a pool of sgRNA-encoding inserts was generated by PCR amplification with primers oJMP697 and oJMP698 from a 78-nt custom oligonucleotide library (2020-OL-J, Agilent) with the following conditions per 500 µl reaction ...
-
bioRxiv - Cell Biology 2023Quote: ... The cells were transfected with either EGFP-AKT2 or EGFP-AKT2+ HA-SIRT5 constructs or left untransfected and after 48 hours were subjected to the Mitostress assay kit (Cat# 103015-100) from Agilent, USA28.
-
bioRxiv - Physiology 2023Quote: ... The molar concentration of cDNA molecules was calculated from the double stranded DNA concentration and the region average size (determined by analyzing each sample on an Agilent 2200 Tapestation instrument (cat#5067–5584 and cat#5067–5585 ...
-
bioRxiv - Plant Biology 2023Quote: ... RNA concentrations and the median size of the RNA fragments from the libraries were assessed using a 5200 Fragment Analyzer System (Agilent). Finally ...
-
bioRxiv - Plant Biology 2023Quote: ... Hexane extract from plant and in vitro biochemical assay products were initially analysed in GC (Agilent Technologies, 7890B and 5977A) using HP-5 MS column (0.25 mm diameter ...
-
bioRxiv - Microbiology 2023Quote: ... The optical density was measured at 540 nm and subtracted from readings at 450 nm using the BioTek Cytation 5 Cell Imaging Multimode Reader (Agilent). Concentrations were calculated from standard curves run in parallel.
-
bioRxiv - Cancer Biology 2023Quote: Mitochondrial DNA copy number was quantified by qPCR on total DNA from gastrocnemius muscle using MxPro Mx3000P real-time PCR Analyzer (Agilent technologies / Stratagene) and determining the mtDNA/nDNA ratio ...
-
bioRxiv - Pathology 2023Quote: ... the effect of conditioned media from Hep3B cells on cell adhesion was evaluated after 24 h of exposure with the xCELLigence System (Agilent,), using phorbol myristate acetate (PMA) ...
-
bioRxiv - Genomics 2023Quote: ... We double-indexed (Kircher et al., 2012) and amplified 25% of each library with PfuTurbo Cx HotStart DNA Polymerase from Agilent. Amplification products were cleaned up using NGS clean-up magnetic beads (Macherey-Nagel) ...
-
bioRxiv - Genomics 2023Quote: ... the concentration and integrity of the RNA were assessed using the ND-1000 UV-visible light spectrophotometer from Nanodrop Technologies and the Bioanalyzer 2100 with the RNA 6000 Nano Lab Chip kit by Agilent.
-
bioRxiv - Molecular Biology 2023Quote: ... The DNA obtained from cell cultures transfected with the RNP complex was amplified by nested PCR using Herculase II Fusion DNA Polymerase (Agilent). The first amplification was performed with primers IG36 and IG37 as follows ...