Labshake search
Citations for Agilent :
1201 - 1250 of 7234 citations for Human Low affinity immunoglobulin gamma Fc region receptor II c FCGR2C ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... We produced the purified 16S V4 rDNA by amplification of the V4 region of Escherichia coli XL 10-gold (Agilent) using TaKaRa Taq R001 AM kit (Clonetech ...
-
bioRxiv - Physiology 2023Quote: ... The molar concentration of cDNA molecules was calculated from the double stranded DNA concentration and the region average size (determined by analyzing each sample on an Agilent 2200 Tapestation instrument (cat#5067–5584 and cat#5067–5585 ...
-
bioRxiv - Neuroscience 2023Quote: ... genes that did not demonstrate at least ≈40% present calls across all transcripts profiled for each region-specific comparison were removed by using Genespring GX 7.3 Expression Analysis software (Agilent Technologies). A two-tailed unpaired T-test ...
-
bioRxiv - Cancer Biology 2023Quote: ... harboring the first intron and exon 2 of the coding region was subcloned into pBluescript and mutagenized using Pfu DNA polymerase (Stratagene/Agilent) with primers GAGCTGCTTCCCGCACCGCCCCTGTCCC and GGGACAGGGGCGGTGCGGGAAGCAGCTC ...
-
bioRxiv - Epidemiology 2019Quote: ... OGTT plasma insulin concentrations were measured by ELISA (Dako UK Ltd., Ely, Cambs, U.K.). Intra-assay imprecision (CV ...
-
bioRxiv - Biochemistry 2019Quote: ... the gene coding for the kinse domain of the Elk receptor was amplified from TKB1 cells (Agilent Technologies, Santa Clara, CA) and cloned with a C-terminal HA-tag between NdeI and EcoRV restriction sites within the second open reading frame of the pCDF-Duet vector ...
-
bioRxiv - Biochemistry 2020Quote: Human ISG15 cDNA was amplified by RT-PCR from universal human reference RNA (Agilent 740000-41), adding BamHI and NotI restriction sites at the 5’ and 3’ ends respectively ...
-
bioRxiv - Cell Biology 2023Quote: Non-codon optimised sequences were amplified from a human cDNA library (MegaMan human transcription library, Agilent). Mis18α ...
-
bioRxiv - Molecular Biology 2019Quote: SEC-MALS was performed on a Dawn Heleos II System with an Optilab T-rEX RI detector (Wyatt) and a 1260 Inifinity II LC system (Agilent). The Superose 6 increase 10/300 column (GE Healthcare ...
-
bioRxiv - Biochemistry 2022Quote: Full-length and loopless Ndc80 complexes were analysed by SEC-MALS on a Dawn Heleos II System with an Optilab T-rEX RI detector (Wyatt) and a 1260 Inifinity II LC system (Agilent). The Superose 6 increase 10/300 column (GE Healthcare ...
-
bioRxiv - Molecular Biology 2023Quote: ... which was amplified using Herculase II Fusion DNA polymerase in 100-µl reaction mixtures (1× Herculase II reaction buffer, 1 mM dNTPs, 200 pM Agilent library ...
-
bioRxiv - Genomics 2019Quote: ... SureSelect Human All Exon V6 (Agilent), and the Human Core Exome Kit + RefSeq V1 (Twist) ...
-
bioRxiv - Pathology 2019Quote: ... and mouse anti-human CD31 (DAKO) was applied overnight at 4°C ...
-
bioRxiv - Genetics 2021Quote: ... Universal Human Reference RNA (UHRR, Agilent) was spiked into each of the samples for a final RNA amount of 300 ng to balance the RNA concentrations in the pools ...
-
bioRxiv - Neuroscience 2021Quote: ... Anti-human tau (Dako, 1:10,000), the phosphorylation specific anti-tau antibody Ser396/Ser404 (PHF1 ...
-
bioRxiv - Neuroscience 2019Quote: ... total tau (total human tau, Agilent), Tau-1 (Millipore) ...
-
The heterogeneity of the DNA damage response landscape determines patient outcomes in ovarian cancerbioRxiv - Cell Biology 2021Quote: ... SureSelect Human All Exon V6 (Agilent) exome libraries were prepared and samples were paired-end whole exome sequenced (WES ...
-
bioRxiv - Cancer Biology 2021Quote: ... human CD45 (Dako M0701, 1:100), and human CD20 (Dako M0755 ...
-
bioRxiv - Cancer Biology 2023Quote: ... human vimentin (1:4000; M0725, DakoCytomation), breast cancer resistance protein (BCRP ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... the Herculase II Fusion DNA Polymerase (Agilent Technologies) was used together with the primers NS1short and RCA95m55 ...
-
bioRxiv - Bioengineering 2019Quote: ... PfuUltra II Fusion HS (Catalog # 600670, Agilent Technologies), Platinum™ SuperFi™ (ThermoFisher Scientific) ...
-
bioRxiv - Genetics 2021Quote: ... in the pBluescript II SK plasmid (Agilent Technologies). The final targeting vector thus contained 4.8 kbp upstream and 7.2 kbp downstream of Col3a1 exon 6.
-
bioRxiv - Immunology 2021Quote: ... or Herculase II Fusion DNA Polymerase (Agilent Technologies). PCR reactions were analysed by agarose gel electrophoresis and PCR products of the predicted size were extracted from the gel using QIAquick Gel Extraction Kit (Qiagen) ...
-
bioRxiv - Plant Biology 2021Quote: ... using Herculase II Fusion DNA Polymerase (Agilent technologies) and DcPAR1.F and DcPAR1.R primers (Supplementary Table I) ...
-
bioRxiv - Cell Biology 2020Quote: ... A 1290 Infinity II UHPLC system (Agilent Technologies) coupled with a 6470 triple quadrupole mass spectrometer (Agilent Technologies ...
-
bioRxiv - Synthetic Biology 2022Quote: ... using a 1290 Infinity II UHPLC (G7120AR, Agilent). The mobile phases used for separation were (A ...
-
bioRxiv - Synthetic Biology 2022Quote: ... using an 1290 Infinity II UHPLC (G7120AR, Agilent). The following method was used for separation ...
-
bioRxiv - Synthetic Biology 2022Quote: ... using a 1290 Infinity II UHPLC (G7120AR, Agilent). The mobile phases used were (A ...
-
bioRxiv - Molecular Biology 2022Quote: ... into the pBluescript II KS-plasmid (Agilent Technologies). For in-frame fusion with Cdk2 and Tti1 fragments ...
-
bioRxiv - Bioengineering 2022Quote: ... Agilent 1260 Infinity II Primary (Agilent Technologies USA), with a diode array detector equipped with a Poroshell 120 EC-C18 column of 2.7 μm particle size was used ...
-
bioRxiv - Microbiology 2021Quote: ... which includes a 1260 Infinity II HPLC (Agilent), a miniDAWN TREOS II MALS detector (Wyatt ...
-
bioRxiv - Neuroscience 2021Quote: ... with Herculase II Fusion DNA Polymerase (#600675, Agilent) according to the following optimized conditions ...
-
bioRxiv - Bioengineering 2020Quote: ... Site-directed mutagenesis (Quick change II, Agilent 200523) was used to introduce the C-terminus cysteine mutation in the DR-A chain using the following primers:
-
bioRxiv - Molecular Biology 2022Quote: A 1290 Infinity II UHPLC system (Agilent Technologies) coupled with a 6470 triple quadrupole mass spectrometer (Agilent Technologies ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA fragments cloned in pBluescript II SK(+) (Agilent), pTriplEx2 (Takara ...
-
bioRxiv - Plant Biology 2019Quote: ... QuikChange II Site-Directed mutagenesis protocol (#200555, Agilent) was used with hot start polymerases Phusion (F530 ...
-
bioRxiv - Genetics 2020Quote: ... using Herculase II Fusion DNA polymerase (Agilent #600677). Multiple reactions of the first PCR were set up for each sample in order to maximize genomic DNA input up to 1000 cell equivalents per sgRNA ...
-
bioRxiv - Immunology 2021Quote: ... pfu ultra II Fusion high fidelity polymerase (Agilent) followed by digestion of the parental plasmid using Dpn1 restriction enzyme ...
-
bioRxiv - Microbiology 2022Quote: ... on a 1260 Infinity II system (Agilent Technologies). A 30 min gradient was applied and the fraction corresponding to the phosphopeptides was collected ...
-
bioRxiv - Microbiology 2022Quote: ... using Herculase II Fusion Enzyme (Agilent, Cheadle, UK) with oligonucleotide primer pairs incorporating pET-46 Ek/LIC vector adapters (Merck ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... A 1290 Infinity II LC system from Agilent coupled to a QTrap 6500+ mass spectrometer with a Turbo-V™ ESI source from Sciex was applied ...
-
bioRxiv - Neuroscience 2022Quote: ... A 1290 Infinity II UHPLC (Agilent Technologies, Germany) coupled with a QTRAP 4500 mass spectrometer (Sciex ...
-
bioRxiv - Biochemistry 2023Quote: The two-column system (1290 Infinity II (Agilent)) with two binary pumps connected to two positions of the ten port valve was equipped with two 30 × 2.1 mm Luna OMEGA 1.6 μm C18 100 Å (Phenomenex ...
-
bioRxiv - Neuroscience 2023Quote: ... Brilliant II SYBR Green QPCR master mix (Agilent) was used to make the reaction mix ...
-
bioRxiv - Cancer Biology 2023Quote: ... using Herculase II Fusion DNA Polymerase (Agilent technologies) and the following program ...
-
bioRxiv - Pathology 2023Quote: ... DAD (Agilent 1260 377 Infinity II DAD WR) and fluorescence detector (FLD ...
-
bioRxiv - Developmental Biology 2023Quote: ... either Herculase II polymerase (Agilent, Santa Clara, CA), Platinum Taq High Fidelity (Thermo Fisher Scientific) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... attached to HPLC (1260 Infinity II; Agilent Technologies) equipped with DAD detectors (G7115A ...
-
bioRxiv - Genomics 2022Quote: ... Brilliant II SYBR Green qPCR MM (Agilent Technologies) and was used ...
-
bioRxiv - Synthetic Biology 2023Quote: ... preparative HPLC (Agilent Technologies 1260 Infinity I/II) was conducted to separate excess ampicillin from PEG-tetra-ampicillin ...