Labshake search
Citations for Agilent :
1151 - 1200 of 7234 citations for Human Low affinity immunoglobulin gamma Fc region receptor II c FCGR2C ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... Kinase dead catalytically inactive versions of Drosophila and human RIOK2 (dRIOK2123A,246A, RIOK2123A,246A) were created using site directed mutagenesis (Lightning Quick Change Kit, Agilent) to make alanine substitutions at catalytic residues Lys-123 and Asp-246 in both human RIOK2 and dRIOK2 as described by other groups (22 ...
-
bioRxiv - Cancer Biology 2022Quote: ... WES libraries were generated by exome capture of approximately 20,000 coding genes using SureSelect human All exon V6 kit (Agilent Technologies) and paired-end sequencing was performed on a HiSeq sequencer (Illumina ...
-
bioRxiv - Cell Biology 2019Quote: ... total leukocyte DNA was enriched using the Agilent SureSelect Human All Exon 50 Mb capture kit (Agilent Technologies, SantaClara, CA). Bidirectional 100-bp paired-end sequencing (Illumina Hi-Seq 2000 ...
-
SMDT1 variants impair EMRE-mediated mitochondrial calcium uptake in patients with muscle involvementbioRxiv - Genetics 2022Quote: ... exome enrichment was performed using the SureSelect Human All Exon 50 Mb Kit V5 (Agilent Technologies, Santa Clara, CA, USA). Sequencing was done on a HiSeq4000 (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: ... FLAG-tagged human SLFN14 D249A was generated by site directed mutagenesis with the QuickChange Lightning Site-Directed Mutagenesis Kit (Agilent) using reverse primer SS1 (5’-atccaccccaatgaggacatatcc-3’ ...
-
bioRxiv - Cancer Biology 2023Quote: ... exome capture was performed on 200 ng DNA using a customised version of the Agilent Human All Exome V5 Kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... Patient M03’s DNA was captured with the SureSelect Human All Exon V6 Kit (Agilent Technologies, Santa Clara, CA, USA) and sequenced on a NextSeq500 (Illumina ...
-
bioRxiv - Cell Biology 2024Quote: Whole exome sequencing on genomic DNA of the patient was performed using the SureSelect Human All Exon V6 kit (Agilent) on an Illumina HiSeq 4000 sequencer ...
-
bioRxiv - Genetics 2021Quote: ... To reproduce the A-variant the following primers were used for SDM by site directed mutagenesis using QuickChange II site directed mutagenesis kit (Agilent Technologies, UK) using the following primers ...
-
bioRxiv - Neuroscience 2020Quote: The point mutations and modifications in the linker sequence between CiVSD and FPs were done using the QuickCjhange II XL site-directed mutagenesis kit (Agilent Technologies, USA). The sequence verification of the novel constructs was done using Tag/dye-termination method (W ...
-
bioRxiv - Neuroscience 2019Quote: ... pcDNA3.1-HA-SorCS1cβ Y1132A and GFP-tagged Rab7 T22N were generated by in vitro mutagenesis using the QuikChange II Site-Directed Mutagenesis Kit (Agilent, Cat #200522) from pcDNA4-SorCS1cβ-myc (kindly provided by Alan D ...
-
bioRxiv - Biochemistry 2020Quote: ... The mutations to generate Asp276AlaSd and Tyr435HisSd were introduced by the QuikChange II Lightning Site-Directed Mutagenesis kit (Agilent, Santa Clara, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: ... LEU4 and Ll_ilvD were generated by error-prone PCR using the GeneMorph II Random Mutagenesis Kit (Agilent Technologies, Santa Clara, CA, USA). The CEN plasmids harboring wild-type ILV6 (pYZ127) ...
-
bioRxiv - Cell Biology 2021Quote: ... The substitution S59D and S59A were introduced into the pLVX-IRES-FLAG-tagged HERPUD1 vector using the QuikChange II XL direct-mutagenesis kit (Stratagene, cat#200522) and the mutagenesis service of GenScript (Hong Kong ...
-
bioRxiv - Plant Biology 2020Quote: ... the HY5 36th Serine (AGC) was changed into Alanine (GCC) and Aspartic Acid (GAC) respectively using Quickchange II site-directed mutagenesis kit (Agilent, Catalog #200523) and cloned into pB7FWG vectors ...
-
bioRxiv - Developmental Biology 2021Quote: ... Deletion and mutation variants were generated using standard cloning techniques and the QuickChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies, 200521).
-
bioRxiv - Cell Biology 2021Quote: ... pIRESneo2-EGFP-TOPBP1-ΔBRCT6 was generated by site directed mutagenesis of pIRESneo2-EGFP-TOPBP1-WT using QuikChange II XL Site-Directed Mutagenesis kit (Agilent Technologies, 200522).
-
bioRxiv - Cell Biology 2022Quote: ... All other constructs were made by PCR amplification followed by standard restriction enzyme cloning or by site-directed mutagenesis kit (QuickChange II, Agilent Technologies, 200523). All oligonucleotides were obtained from Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... and antisense primer (5’-GGA GAA AGG CAC CTG CCA GGC CTC AAC-3’) by site-directed mutation according to manufacturer’s protocol (QuikChange II XL Site-Directed Mutagenenesis Kit, 200521; Stratagene, LA Jolla, CA). The primers were designed to delete (in frame ...
-
bioRxiv - Developmental Biology 2022Quote: ... we introduced several point mutations variants in the Pax8 binding site using the QuikChange® II XL Site-Directed Mutagenesis Kit (Agilent Technologies) to generate the CNS1 mut-Luc vector ...
-
bioRxiv - Cell Biology 2022Quote: ... MD and mutated at AKAP12’s activation-responsive sites (S/T to A mutations) using the QuikChange II® site-directed mutagenesis Kit (Stratagene, CA) as we described previously (54) ...
-
bioRxiv - Biochemistry 2021Quote: ... HSF1-S326A and HSF1-T527A were carried out using a QuikChange II XL Site-Directed Mutagenesis kit (Agilent Technologies, Santa Clara, CA) as per the manufacturer’s instructions ...
-
bioRxiv - Pathology 2020Quote: ... Mutations required for domain excision and/or punctual changes within P1 nucleotidic sequence were introduced in the P1 open reading frame using the QuikChange® II XL Site-Directed mutagenesis kit (Agilent-Stratagene) and related primers (Appendix Table 1) ...
-
bioRxiv - Cell Biology 2020Quote: ... All STIM1 variants were generated from the wild-type (WT) construct by site-directed mutagenesis using the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene, Massy, France). All resulting plasmids were checked by Sanger sequencing.
-
bioRxiv - Genetics 2019Quote: ... The site-directed mutagenesis was used to generate the constructs containing the other allele not amplified from initial cloning with the Quick Change II Site-Directed Mutagenesis Kit (Agilent Technology, USA). All the constructed plasmids were validated by sequencing and did not contain any other sequence variations ...
-
bioRxiv - Immunology 2021Quote: Point substitutions within RBD in SARS-CoV-2 spike gene were introduced by site-directed mutagenesis using the QuikChange II kit (Agilent Technologies Inc.) following the manufacturer’s protocol and by overlapping PCR strategy as described previously (Patil et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... was derived from pcDNA-V5-hWls (EVI/WLS-V5, Belenkaya et al, 2008) using the QuikChange II Site-Directed Mutagenesis Kits (200523, Agilent Technologies Inc.) according to the manufacturer’s instructions and the primers CGGAACATCAGTGGGAGGCAGTCCAGCCTGCCAGCTATGAGCAGAGTCCGGCGGC and GCCGCCGGACTCTGCTCATAGCTGGCAGGCTGGACTGCCTCCCACTGATGTTCCG ...
-
bioRxiv - Cell Biology 2020Quote: ... E706A/E1015A and E437A/E706A/E1015A=EallA) were obtained by site-directed mutagenesis of pCS2-3×HA-NFATc3 using the QuickChange® II XL kit (Agilent Technologies) using the indicated primers ...
-
bioRxiv - Biochemistry 2022Quote: ... The phPAI-1 library was generated by error prone PCR using the GeneMorph II Random Mutagenesis Kit (Agilent Technologies, Santa Clara, CA) with primers that maintain the AscI and NotI restriction sites (SI Table 1) ...
-
bioRxiv - Physiology 2023Quote: ... Mutations were introduced by PCR-based site-directed mutagenesis method using the Quick Change II XL Site-Directed Mutagenesis Kit (Agilent Technologies, USA) and verified by sequencing (Supplementary Table 2).
-
bioRxiv - Biophysics 2023Quote: ... the following HIV-1 IN mutants were prepared using the QuikChange II XL site directed mutagenesis kit (Agilent Technologies, Santa Clara, CA): E138K ...
-
bioRxiv - Biophysics 2022Quote: Point substitutions within RBD in SARS-CoV-2 spike gene were introduced by site-directed mutagenesis using the QuikChange II kit (Agilent Technologies Inc.) following the manufacturer’s protocol and by overlapping PCR strategy as described previously (33) ...
-
bioRxiv - Genetics 2023Quote: ... and Illumina adapters were added (second PCR) in a nested PCR manner using Agilent Herculase II Fusion DNA Polymerase Kit (Agilent, Cat # 600679). The PCR products were purified and sequenced using an Illumina NextSeq ...
-
bioRxiv - Systems Biology 2023Quote: The genomic integrated sgRNA libraries were amplified and indexed in two rounds of PCR using the Herculase II Fusion DNA Polymerase kit (Agilent Technologies 600679). The libraries were sequenced on an Illumina NextSeq with a custom primer oMCB1672 for read 1 and ≥21 cycles in read 1 ...
-
bioRxiv - Physiology 2024Quote: cDNA encoding the mouse γ subunit was mutated to replace 140RKRR143 with 140QQQQ143 using the QuckChange II XL mutagenesis kit (Agilent Technologies). cDNAs encoding ENaC’s mouse α ...
-
bioRxiv - Immunology 2023Quote: ... Mutations were introduced into cDNAs using the QuikChange II XL Site-Directed Mutagenesis kit (Agilent, Santa Clara, CA, USA; cat. no. 200521) to construct expression vectors for S variants with a single amino acid change ...
-
bioRxiv - Cell Biology 2023Quote: ... GYF motif mutant GIGYF1 (GIGYF1 GYF Mut; G502A, Y503A, F504A) plasmids were created using the QuikChange II Site-Directed mutagenesis kit (Agilent Technologies, 200523). The chimeric constructs were synthesized by GenScript (Piscataway ...
-
bioRxiv - Cell Biology 2023Quote: pLV-CMV-IRIS-PURO-c-Src-mScarlet plasmid was used to the generation of Y527F and Y527F/K295R mutants via QuickChange II Site-Directed Mutagenesis Kit (Agilent Technologies, 200523) according to manufacturer’s protocol using the primers listed in Table 1.
-
Atypical epigenetic and small RNA control of transposons in clonally reproducing Spirodela polyrhizabioRxiv - Plant Biology 2024Quote: ... Probes produced from PCR templates were radiolabelled with [α-32P]-dCTP (Hartmann Analytic, #SRP-305) using Prime-it II Random Primer Labelling kit (Agilent, #300385) and oligonucleotides used as a probe were radiolabelled with [γ-32P]-ATP (Hartmann analytic #SRP-501) ...
-
bioRxiv - Molecular Biology 2024Quote: ... sgRNA-encoding genomic loci were amplified from up to 400 µg gDNA via PCR using a Herculase II Fusion Polymerase PCR kit (Agilent, Cat. #600677). Pooled reaction products from each treatment group were uniquely barcoded in a subsequent PCR reaction followed by electrophoresis on 2% TBE-agarose gel at 120 V ...
-
bioRxiv - Molecular Biology 2024Quote: All mutants were generated by site-directed mutagenesis with the QuikChange XL II site-directed mutagenesis kit (Agilent, Santa Clara, CA, USA), as previously described (33).
-
bioRxiv - Biochemistry 2020Quote: ... variant hLPYK proteins were created by mutating the coding region of the pLC11 plasmid (originally a kind gift from Dr. Andrea Mattevi 28) using QuikChange (Stratagene) and primers designed to individually obtain all 19 substitutions at each position ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... or with minor N-terminal truncations to exclude the transmembrane regions (Sphaeroforma arctica: amino acids 21-316; Auxenochlorella protothecoides: amino acids 21-327) in Arctic Express DE competent cells (Agilent). At the N-terminus ...
-
bioRxiv - Molecular Biology 2020Quote: ... Mutations in nsp7 and nsp8 coding region in pET21a constructs were introduced following the Quickchange site-directed mutagenesis protocol (Stratagene). All constructs were transformed into Escherichia coli BL21(DE3 ...
-
bioRxiv - Microbiology 2021Quote: A library of IpaC mutants with missense mutations in the coiled-coil domain and flanking regions was generated using error-prone PCR with the GeneMorphII (Agilent) domain mutagenesis kit ...
-
bioRxiv - Systems Biology 2020Quote: Block 3-6s for the motif-rich core regions of our synthetic promoter constructs were amplified from a library synthesized by Agilent Technologies (LeProust et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... A Ddyo7-mCherry expression plasmid was generated by first TA cloning a PCR product (myo42 to myi185+2) encompassing the myoi 3’ region of the gene (aa 475 - end) minus the stop codon using StrataClone (Agilent) (pDTi289+2) ...
-
bioRxiv - Cancer Biology 2021Quote: Using Agilent Technologies’ custom CGH-array format we arrayed 932 out of 1092 regions from the chromatin accessibility signature (Agilent probes were not available to cover the remaining 160 regions) ...
-
bioRxiv - Genetics 2022Quote: ... A ∼400bp region around the expected Cas9 cut site in exon1 of EXOSC2 was amplified by PCR using PfuTurbo DNA polymerase (Agilent), according to the manufacturer’s instructions using primers ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... were introduced into the CXCR4-coding region of the CXCR4-rluc3 vector using the QuikChange site-directed mutagenesis method (Stratagene). The plasmid used to express renilla GFP (rGFP ...