Labshake search
Citations for Agilent :
1101 - 1150 of 7234 citations for Human Low affinity immunoglobulin gamma Fc region receptor II c FCGR2C ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: Site-directed mutagenesis of SARS-CoV-2 spike was performed with the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent 200522), using primers listed in Supplementary table S2 and according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... The desired PNUTS mutant in the RVXF motif (converting the RISW motif to RASA) was generated by oligonucleotide-mediated site-directed mutagenesis (QuikChange II XL Site-Directed Mutagenesis Kit, Agilent Technologies) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... The S71A and S71E mutations were introduced into the pDONR221-gCDC42attb plasmid with the QuickChange II XL Site directed mutagenesis kit (#200521, Agilent technologies) with the following primers ...
-
bioRxiv - Cell Biology 2023Quote: ... The S71A mutation was introduced into the pMALc-MBP::CDC-42 plasmid with the QuickChange II XL Site directed mutagenesis kit (#200521, Agilent technologies) with the following primers ...
-
bioRxiv - Biochemistry 2023Quote: Mutations were generated by site-directed mutagenesis (table 2) on this plasmid using QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) and plasmids were verified through sequencing through the Molecular Informatics Core at the University of Rhode Island.
-
bioRxiv - Biochemistry 2023Quote: ... The desired PP1 or PNUTS mutants were generated by oligonucleotide- mediated site-directed mutagenesis (QuikChange II XL Site-Directed Mutagenesis Kit, Agilent Technologies) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... we first inserted the SalI site at just downstream of the termination codon of the dsRed cDNA of pIRES2-dsRed-IRF418 using a QuickChange II Site-Directed Mutagenesis Kit (Agilent Technologies), and isolated the BglII-SalI fragment containing the mIRF4-IRES-dsRed DNA region from the mutated plasmid ...
-
bioRxiv - Cell Biology 2023Quote: ... Twin-strep-Flag-HALO-DVL3 or pCS2+xDvl3 vector was performed using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies) following a manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... GGC -> GGT) of dCas9 on pKR387 to remove an AscI recognition site using the QuikChange II site-directed mutagenesis kit (Agilent #200523). The resulting product was transformed into NEB 10-beta cells using a standard heat shock protocol and transformants were selected on LB agar plates with 100 μg/mL of carbenicillin ...
-
bioRxiv - Molecular Biology 2020Quote: ... and Herculase II Fusion DNA Polymerase (Agilent). The libraries were sequenced on an llumina NextSeq 500 system with 75 bp read length ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we preformed PCR using PFUultra II (Agilent), the primers F1 and R3 5’gaggtgggcagtcatccatc3’ ...
-
bioRxiv - Genomics 2020Quote: ... the Herculase II Fusion DNA Polymerase (Agilent) was used according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... Herculase II Fusion DNA Polymerase (Agilent Technologies), 0.25 mM dNTPs (100 mM ...
-
bioRxiv - Genetics 2020Quote: ... Herculase II Fusion DNA Polymerase (Agilent Technologies), 0.25 mM dNTPs (100 mM ...
-
bioRxiv - Biochemistry 2022Quote: ... using PfuUltra II HS DNA Polymerase (Agilent) and primers oADW0274/0275 and cloned into Sma I/CIAP cut pLBG003 to generate plasmid pLBG007 [rips-1prom::RIPS-1::GFP::rips-1 3 UTR] (referred to as RIPS-1::GFP) ...
-
bioRxiv - Neuroscience 2021Quote: ... using QuikChange II XL (Agilent Cat #200521) and primers Irk1-RR-F and Irk1-RR-R ...
-
bioRxiv - Physiology 2022Quote: ... An HPLC 1290 Infinity II - (Agilent Technologies) consisting of a 4-channel binary pump ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed using Herculase II (Agilent) or Q5 High-fidelity DNA Polymerase (New England Biolabs).
-
bioRxiv - Immunology 2020Quote: ... Quick Change II Site-directed mutagenesis (Agilent) was used to revert mutated sites to the native sequence ...
-
bioRxiv - Genetics 2020Quote: ... 1 µl of Herculase II polymerase (Agilent), 1 µl of DMSO ...
-
bioRxiv - Microbiology 2021Quote: ... or Herculase II fusion DNA polymerase (Agilent) was used for gyrA ...
-
bioRxiv - Molecular Biology 2021Quote: ... PfuUltra II Fusion HotStart DNA Polymerase (Agilent), Accuprime Taq (Thermo Fisher Scientific) ...
-
bioRxiv - Bioengineering 2022Quote: ... or Agilent Infinite II 1260 (Agilent Technologies) equipped with a refractive index detector and Hi-Plex H ...
-
bioRxiv - Cancer Biology 2022Quote: ... column and HPLC (Agilent 1260 Infinity II). The dried peptides were reconstituted in the mobile phase constituting 30% ACN + 0.1% TFA and loaded on to the column ...
-
bioRxiv - Systems Biology 2022Quote: ... 1 ul of Herculase II polymerase (Agilent), 1 ul of DMSO ...
-
bioRxiv - Physiology 2023Quote: ... and pBluescript II SK+ vector DNA (Stratagene) as stuffer DNA to achieve a final concentration of 120 ng/μl ...
-
bioRxiv - Cancer Biology 2022Quote: ... using Herculase II Fusion DNA Polymerase (Agilent) and 16 cycles ...
-
bioRxiv - Microbiology 2023Quote: ... or Pfu ultra II fusion HS (Agilent) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2) the pBluescript II SK (-) vector (Agilent) following EcoRV digestion ...
-
bioRxiv - Cancer Biology 2023Quote: ... using Herculase II Fusion DNA Polymerase (Agilent) and 16 cycles ...
-
bioRxiv - Systems Biology 2023Quote: ... 1 μl of Herculase II polymerase (Agilent), 1 μl of DMSO ...
-
bioRxiv - Immunology 2023Quote: ... Site directed mutagenesis (QuikChange II, Agilent, 200523) was performed to introduce a cysteine in position 253 or 107 and 311 to form the covalently bound dimers and a histidine in position 101 to disrupt FLE using the following primers and validated by DNA sequencing.
-
bioRxiv - Cell Biology 2023Quote: ... High-fidelity DNA polymerase PfuUltra II (Stratagene) was performed for site-directed mutagenesis ...
-
bioRxiv - Molecular Biology 2024Quote: ... using the Herculase II Fusion polymerase (Agilent). Illumina P5- and P7-barcoded adaptors were used and PCR amplification and quality controls have been carried out as described by Zhang laboratory (Joung et al ...
-
bioRxiv - Biochemistry 2020Quote: ... Daily MS calibration was performed with ESI-L Low Concentration Tuning Mix (Agilent Technologies). The internal calibrant was Hexakis(1H,1H,3H-tetrafluoropropoxy)phosphazene (Synquest Laboratories) ...
-
bioRxiv - Immunology 2019Quote: ... or low pH antigen retrieval buffer (Dako Target retrieval Solution, pH 6, Dako, Denmark) (for PCNA) ...
-
bioRxiv - Cell Biology 2022Quote: ... Secondary incubation was performed with a rabbit anti mouse Fc fragment (Dako Agilent Z0412), then grids were incubated with Protein A-Gold 10 nm (Cell Microscopy Center ...
-
bioRxiv - Cell Biology 2022Quote: ... Secondary incubation was performed with a rabbit anti mouse Fc fragment (Dako Agilent Z0412), then grids were incubated with Protein A-Gold 10 nm (Cell Microscopy Center ...
-
bioRxiv - Immunology 2021Quote: ... washed twice with PBS/2% FCS and stained with PE (Prozyme, 20 µg/ml). RNA flow cytometry measurement of Bhlhe40 expression was performed using the PrimeFlow RNA Assay (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: Quality and quantification of the Hi-C libraries was assessed using the 2100 Bioanalyzer (Agilent, DNA 7500 kit). An equimolar pool of the different samples was sequenced on the Illumina NextSeq 550 System in a 75bp paired-end setup ...
-
bioRxiv - Genomics 2023Quote: Quality and quantification of the Hi-C libraries was assessed using the 2100 Bioanalyzer (Agilent, DNA 7500 kit). Four biological replicates have been pooled in an equimolar manner and subjected to sequencing using the Illumina NextSeq 550 System in a 75bp paired-end setup ...
-
bioRxiv - Cancer Biology 2021Quote: ... the plasma was diluted 4:1 with Buffer A for Multiple Affinity Removal LC Columns (Agilent Technologies) and filtered through a 0.22 μm hydrophilic PVDF membrane filter plate (Millipore ...
-
bioRxiv - Immunology 2021Quote: ... sections were immunolabelled using a rabbit anti-MPO polyclonal affinity purified antibody (1:500; Dako Omnis, A0398) and incubated with Dako anti-rabbit HRP polymer (Agilent ...
-
bioRxiv - Cancer Biology 2022Quote: ... fixed tissues were embedded in paraffin and 4 mm sections were histologically processed for hematoxylin-eosin staining and immunohistochemistry using anti-human Ki67 antibody (DAKO #M7240, 1:75, 30 min at 37°C). All these procedures were performed using standardized protocols by Atrys Health S.A.
-
bioRxiv - Biochemistry 2020Quote: ... Samples were heated from 25 °C to 96 °C at 1 °C/min using an Mx3005P qPCR machine (Agilent Technologies). The dye was excited at 492 nm ...
-
bioRxiv - Genomics 2019Quote: ... The sheared DNA was used to prepare indexed whole exome sequencing libraries using the Agilent SureSelect XT Human all exon v6 + UTR kit (Agilent Technologies ...
-
bioRxiv - Cell Biology 2019Quote: ... Agilent gene expression microarray 60K slide (Design ID: 72363. SurePrint G3 Human Gene Expression 8 × 60K Microarray Kit, Agilent Technologies) were used ...
-
bioRxiv - Genomics 2019Quote: ... or 100 ng of gDNA was assembled into exome sequencing libraries using the SureSelect Human All Exon V7 Exome kit (Agilent). DNA samples were pooled to achieve an on-bait depth of 100× for the buffy coat gDNA and 300× for the plasma cfDNA.
-
bioRxiv - Cancer Biology 2019Quote: ... Library preparation was performed using SureSelect Human All Exon Kit v5 (cat# 5990-9857EN, Agilent Technologies, Santa Clara, CA, USA), sequencing was performed on the Illumina Xten platform ...
-
bioRxiv - Neuroscience 2021Quote: Exonic sequences were enriched with the SureSelect Human All Exon 50□Mb V5 Kit (Agilent Technologies, Santa Clara, CA, USA). Sequences were generated on a HiSeq2500 (Illumina ...