Labshake search
Citations for Agilent :
1251 - 1300 of 7234 citations for Human Low affinity immunoglobulin gamma Fc region receptor II c FCGR2C ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2023Quote: ... using a 1290 Infinity II UHPLC (G7120AR, Agilent). The mobile phases used were (A ...
-
bioRxiv - Molecular Biology 2023Quote: ... using a 1260 Infinity II HPLC system (Agilent) coupled to a miniDAWN TREOS and Optilab T-rEX refractive index detector (Wyatt Technology).
-
bioRxiv - Biochemistry 2024Quote: ... HPLC 1260 Infinity II LC System (Agilent Technologies) with RI detector ...
-
bioRxiv - Neuroscience 2020Quote: ... sections were boiled for 20 minutes in low pH buffer (pH 6.1; Dako, CA, USA). Endogenous peroxidase activity and non-specific binding were blocked by incubation with 3% hydrogen peroxide in methanol for 15 minutes followed by 5% normal goat serum (Vector Laboratories ...
-
bioRxiv - Biochemistry 2022Quote: ... The m/z scale was calibrated using the ESI-L low concentration tune mix (Agilent). As the dynamic-field IMS systems including TIMS cannot measure the absolute K values a priori ...
-
bioRxiv - Plant Biology 2024Quote: ... Low ROX (95074; Quanta BioSciences) in a Stratagene Mx4000 multiplex quantitative PCR system (Agilent Technologies) using primers for Drosophila 18S and 28S rRNA ...
-
bioRxiv - Cell Biology 2020Quote: ... Secondary incubation was next performed with a rabbit anti mouse Fc fragment (Dako Agilent Z0412). Grids were incubated with Protein A-Gold 10 nm (Cell Microscopy Center ...
-
bioRxiv - Cell Biology 2020Quote: ... Secondary incubation was next performed with a rabbit anti mouse Fc fragment (Dako Agilent Z0412). Grids were incubated with Protein A-Gold 10 nm (Cell Microscopy Center ...
-
bioRxiv - Physiology 2020Quote: ... blocked in 20% fetal calf serum (FCS) and incubated with anti-insulin (1/10, Dako) in Antibody Diluent for 2h ...
-
bioRxiv - Biochemistry 2020Quote: Affinity depletion of abundant serum proteins was carried out on a HP1290 HPLC system (Agilent, Santa Clara, CA) using the Multiple Affinity Removal Column Human 14 (MARS 14 ...
-
bioRxiv - Genomics 2022Quote: ... and bound antibodies were visualized with peroxidase-conjugated affinity-purified donkey anti-mouse or anti-rabbit IgG (Dako) using LuminateTM Forte Western HRP Substrate (Merck Millipore) ...
-
bioRxiv - Cancer Biology 2021Quote: Comparative gene expression profiling of the prostate cancer cells starved for glutamine for 24 h or cultured with glutamine supplementation was performed using SurePrint G3 Human Gene Expression 8×60K v3 Microarray Kit (Design ID 039494, Agilent Technologies) according to manufacturer’s recommendations as described previously 4 ...
-
bioRxiv - Genetics 2020Quote: Trio WES of 13 patients and their parents was performed using the SureSelect Human All Exon V5+UTR kit (Agilent technologies). In patient 4 ...
-
bioRxiv - Genomics 2019Quote: Paired-end DNA sequencing libraries of 28 individuals were generated using Aglilent SureSelect Human All ExonV6 kit (Agilent Technologies, CA, USA) by Novogene Co. ...
-
bioRxiv - Cell Biology 2020Quote: To identify the causative mutation in these families we sequenced the whole exome of the affected individuals with the SureSelect human AllExon 50Mb kit (Agilent Technologies) and sequenced on the HiSeq 2500 (Illumina ...
-
bioRxiv - Neuroscience 2020Quote: ... Human α7-nAChR R208I-GFP and E211N-GFP were generated from pcDNA3.1-CHRNA7-mGFP and human α3-nAChR I284R-GFP and N287E-GFP were generated from human α3-nAChR-GFP by PCR based QuikChange® Site-Directed Mutagenesis Kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... Exome sequencing was performed on genomic DNA from Patients 1 and 2 and their parents using a SureSelect Human All Exon kit (Agilent Technologies) for targeted enrichment ...
-
bioRxiv - Microbiology 2022Quote: ... hepaticus versus the tdTomato fluorescent protein (72 h transduction) was quantified in epithelial intestinal HT-29 cells using the Human GE 4x44K v2 Microarray Kit (Agilent Technologies) as we previously detailed [13 ...
-
bioRxiv - Pathology 2023Quote: ... with the mouse Prnp encoding the 3F4 epitope (109M, 112M human numbering) was used as a template for site-directed mutagenesis (QuikChange Site Directed Mutagenesis kit™) (Agilent). PrP-deficient RK13 cells (ATCC ...
-
bioRxiv - Cancer Biology 2023Quote: Deletions of SP1 sites on human MGMT promoter were performed using Quick-Change XL Site-Directed Mutagenesis kit (Agilent Technologies, USA).34 The mutated promoters were further cloned into pGL3 basic vector ...
-
bioRxiv - Molecular Biology 2024Quote: ... genomic DNA was fragmented into 180–280 bp by sonication and subjected to library preparation using the Agilent SureSelect Human All Exon V6 Kit (#5190-8864, Agilent Technologies). The enriched libraries underwent paired-end 150bp sequencing on the Illumina HiSeq 2000 platform.
-
bioRxiv - Biophysics 2024Quote: The recombinant human Cα subunit of cAMP-dependent protein kinase with the Phe to Ala mutation in position 100 (PKA-CF100A) was generated from the human PKA-Cα wild-type using Quik-Change Lightning mutagenesis kit (Agilent genomics). The key resource table lists the PCR primers used to modify the pET-28a expression vector encoding for the wild-type human PKA-Cα gene (PRKACA – uniprot P17612 ...
-
bioRxiv - Cell Biology 2020Quote: ... pEGFP-C1-tubbyCT R332H and pEGFP-C1-tubbyCT Y343F were generated using QuikChange II XL Site-Directed mutagenesis kit (Stratagene, Agilent Technologies, Waldbronn, Germany). pEGFP-C1-tubbyCT KR330/332AA was generated by mutagenesis PCR using PfuUltra II Hotstart PCR Master Mix (Agilent Technologies ...
-
bioRxiv - Biochemistry 2019Quote: The eGFP-K17E construct for the mammalian expression of the SERF1a single-point mutant eGFP-K17E was generated by site-directed mutagenesis according to the QuickChange II mutagenesis kit manual (Agilent, Santa Clara, CA), using pEGFP/SERF1a (Tab ...
-
bioRxiv - Immunology 2022Quote: ... a variant mutated to change the tyrosines at positions 179 and 181 to phenylalanines was generated using a QuikChange II Site-Directed Mutagenesis Kit (#200523; Agilent, Santa Clara, CA) and the primer 5’ CATCCCCGCCTTCGCCTTCTATGTCTCACGTTGG 3′ ...
-
bioRxiv - Biochemistry 2022Quote: ... The pcDNA3.1 Flag-mRBPJ A284V CRr and the pcDNA3.1 Flag-mRBPJ F261A/A284V CRr were generated via site directed mutagenesis using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies 200521-5) accordingly to manufacturer’s instructions with the oligos listed in Table S6 and using the pcDNA3.1 Flag-mRBPJ WT CRr and the pcDNA3.1 Flag-mRBPJ A284V CRr as templates ...
-
bioRxiv - Pathology 2019Quote: ... FLAG-tag was inserted between the CAAX motif (CVIQ) and stop codon in the full-length construct (Cat No: 200523, QuickChange II Site-Directed Mutagenesis kit, Agilent Technologies, Lexington, MA). For removal of the INF2 cleavage site ...
-
bioRxiv - Plant Biology 2020Quote: ... Site-directed mutagenesis to generate the different H3.1 point mutant constructs was performed using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA). The ADA2b coding sequence was cloned into pETDuet-1 (Millipore ...
-
bioRxiv - Plant Biology 2019Quote: ... Mutations found in Bgh51 of Australian isolates were introduced into pYES-Bgh51wt through a QuickChange II site-directed mutagenesis kit (Stratagene, La Jolla, CA).
-
bioRxiv - Genetics 2020Quote: ... a natural NcoI restriction enzyme site located within intron 3 of the SPINK1 gene in the context of the previously constructed Mut expression vector was firstly eliminated by means of the QuickChange II XL Site-Directed Mutagenesis Kit (Agilent, Les Ulis, France) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... Variants were introduced into the wild type constructions using the Quick-change II XL site-directed mutagenesis kit (Agilent, Santa Clara, CA, USA). Presence of an abnormally spliced transcript associated with the decrease of the normal transcript was considered as “Impact on splicing” ...
-
bioRxiv - Cell Biology 2022Quote: ... were introduced into the plasmid pED-FLAG-LMAN1 and pcDNA-MCFD2-Myc separately using the QuickChange site-directed mutagenesis II XL kit from Agilent (Santa Clara, CA). FVIII mutant constructs Δ807–816 (deletion of amino acids 807-816 of FVIII ...
-
bioRxiv - Physiology 2023Quote: ... to alanine(s) (A) or glutamate(s) (E) by site-directed mutagenesis using the QuikChange II XL Site-Directed Mutagenesis kit (Agilent, Santa Clara, CA) of a pDUAL2-CCM(- ...
-
bioRxiv - Physiology 2022Quote: ... The dynamin-2 mCherry mutations A618T and S619L were constructed by site directed-mutagenesis using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies, Texas, USA). (DYN2 isoform aa ...
-
bioRxiv - Cell Biology 2023Quote: ... Point mutations were introduced into ATP8B2 and ATP8B4 using the QuikChange II XL site-directed mutagenesis kit (Agilent Technologies, Santa Clara, CA, USA) and/or the SLiCE cloning method (Zhang et al ...
-
bioRxiv - Cell Biology 2023Quote: ... The human GABAA receptor α1 subunit missense mutations (S76R, R214C, D219N, G251D, P260L, M263T, T289P, and A322D) were constructed using QuikChange II site-directed mutagenesis Kit (Agilent Genomics, catalog #: 200523). Enhanced cyan fluorescent protein (CFP ...
-
bioRxiv - Physiology 2023Quote: ... Point mutations were generated using the QuikChange II XL Site-Directed Mutagenesis or Multi Site-Directed Mutagenesis Kit (Agilent Technologies, Cedar Creek, TX) according to the manufacturer’s instructions ...
-
bioRxiv - Zoology 2020Quote: ... Positively immunostained regions showed a golden dark brown color using 3,3’-diaminobenzidine tetrahydrochloride (DAB) as chromogen and H2O2 reaction substrates (DakoCytomation, Glostrup, Denmark). All sections were counterstained with Maeyer’s hematoxylin.
-
bioRxiv - Cancer Biology 2023Quote: ... harboring the first intron and exon 2 of the coding region was subcloned into pBluescript and mutagenized using Pfu DNA polymerase (Stratagene/Agilent) with primers GAGCTGCTTCCCGCACCGCCCCTGTCCC and GGGACAGGGGCGGTGCGGGAAGCAGCTC ...
-
bioRxiv - Developmental Biology 2019Quote: ... Capacity for three-dimensional human blood vessel formation was quantified two weeks later using human CD31 (DAKO) immuno-histochemistry of harvested Matrigel plugs ...
-
bioRxiv - Cell Biology 2021Quote: ... or IRBITKO cells was subjected to PCR amplification (Herculase II Fusion DNA Polymerase and 5X Herculase II PCR Buffer and dNTP (Agilent Techologies) using primers flanking the region targeted by the gRNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... and pre-treated in citrate buffer (EnVision FLEX Target Retrieval Solution Low pH, Agilent-Dako, K8005) using a PT Link module (Dako) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and pre-treated in citrate buffer (EnVision FLEX Target Retrieval Solution Low pH, Agilent-Dako, K8005) using a PT Link module (Dako) ...
-
bioRxiv - Cancer Biology 2022Quote: ... NGS libraries were created using Sure Select XT2 Low input Custom library probes (Agilent Technologies Inc.). The probe set was custom designed by Cogentech (OncoPan panel ...
-
bioRxiv - Cancer Biology 2019Quote: ... The whole-exome sequencing libraries were prepared with the SureSelect Low Input Target Enrichment System (Agilent) and sequenced pair-ended on Illumina HiSeq ...
-
bioRxiv - Cell Biology 2022Quote: ... After 16 h of stress in low glucose growth medium (1 g/L; Agilent Technologies, 103577), cells were washed once with PBS ...
-
bioRxiv - Cell Biology 2024Quote: ... or rehydrated and antigen retrieved with EnVision Flex Target Retrieval Solution Low or High pH (Agilent, Cat#K8004 for the high and Cat#K8005 for the low pH ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... at 4 °C overnight and immunostained using the streptavidin-biotin peroxidase technique (Envision universal peroxidase kit; Dako Cytomation, Milan, Italy). After incubation ...
-
bioRxiv - Cancer Biology 2022Quote: ... and dual-color reagent Anti-human Kappa light chain/Anti-Human Lambda light chains/RPE (Dako, FR481 X0935). Results were analyzed with Kaluza software version 2.1 (Beckman coulter).
-
An endothelial SOX18-mevalonate pathway axis enables repurposing of statins for infantile hemangiomabioRxiv - Molecular Biology 2024Quote: ... followed by incubation with an anti-human CD31 monoclonal antibody (1:30, mouse anti-human; Dako, Glostrup, 0823) to stain for human endothelium ...