Labshake search
Citations for Agilent :
701 - 750 of 1491 citations for Urotensin II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... H3 S10A and H3 S10E using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent technologies, cat#200521) according to manufacturer’s instruction ...
-
bioRxiv - Biochemistry 2019Quote: ... using a linear gradient from 5 to 55% acetonitrile over 6.5 min with 0.1% formic acid as the aqueous mobile phase after an initial hold at 95% 0.1% formic acid for 0.5 min (0.6 mL/min) using a 1290 Infinity II UHPLC (G7120AR, Agilent). Peptides were identified using LC-HRMS as described previously.23
-
bioRxiv - Cell Biology 2021Quote: ... site directed mutagenesis was carried out by using Quik Change II Site-Directed Mutagenesis Kit (Agilent, USA). The primers used were ...
-
bioRxiv - Synthetic Biology 2021Quote: ... the homology arms containing plasmid was mutated using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent, #200522) to delete the single-guide RNA (sgRNA ...
-
bioRxiv - Biochemistry 2021Quote: ... Site Directed Mutagenesis was carried out using the QuikChange Lightning II cloning kit (Agilent, Santa Clara, CA). PCR cloning was carried out using the NEB PCR cloning kit ...
-
bioRxiv - Plant Biology 2020Quote: ... and the NRG1.1 variants were generated following the QuikChange II Site-Directed mutagenesis (SDM) protocol (#200555, Agilent). Level 0 golden gate compatible construct for the genomic sequence of Col-0 EDS1 (AT3G48090.1 ...
-
bioRxiv - Biochemistry 2020Quote: ... All mutants of IFITM3 were generated by using QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies, #200523). Lipofectamine 3000 from Thermo Scientific was used for transfection of HEK293T cells.
-
bioRxiv - Cell Biology 2021Quote: ... The QuikChange II XL direct-mutagenesis kit was obtained from Stratagene (cat#200522, La Jolla, CA, USA) and the Vybrant Apoptosis Pacific Blue-annexin V kit and 7AAD from Invitrogen (cat#A35122).
-
bioRxiv - Cell Biology 2021Quote: ... The non-phosphorylatable sts5 sequences were generated by either site directed mutagenesis using QuikChange II mutagenesis (Stratagene) or mutant sequences were synthesized as a gBlocks Gene Fragment (Integrated DNA Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... Point mutants were generated using the QuikChange II site-directed mutagenesis kit (Agilent Technologies, Santa Clara, CA), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... and were used to PCR amplify around the pMMB67EH plasmid using PfuUltra II high-fidelity polymerase (Agilent). PCR products were purified (QIAGEN ...
-
bioRxiv - Microbiology 2022Quote: ... were generated using the QuikChange II XL site-directed mutagenesis kit according to the manufacturer’s instructions (Agilent). To make the constructs for expression of stabilized soluble S2P spike trimer proteins ...
-
bioRxiv - Microbiology 2022Quote: ... Altered rsmY and rsmZ reporters were constructed using the QuikChange II XL site-directed mutagenesis kit (Agilent) following the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2022Quote: ... Mutagenesis and all DNA modifications were carried out using Pfu Ultra II Hotstart 2X Master Mix (Agilent). Mutagenesis primers for hIP3R1 F2586K forward (TCTTCATGGTCATCATCATTGTTCTTAACCTGATTAAGGGGGTTATCATTGACACT) ...
-
bioRxiv - Plant Biology 2021Quote: ... HPLC-UV and HPLC-fluorescence analysis were performed using a 1220 Infinity II LC system (Agilent Technologies) coupled to a Prostar 363 fluorescence detector (Varian) ...
-
bioRxiv - Microbiology 2021Quote: ... site-directed mutagenesis was performed on pCMVΔR8.91 using the QuickChange II-XL site-directed mutagenesis kit (Agilent) according to manufacturer’s instructions and using the primers listed in Supplementary Table 1 ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 Spike mutations were introduced using the QuikChange II XL site-directed mutagenesis protocol (Stratagene). The presence of the desired mutations was determined by automated DNA sequencing ...
-
bioRxiv - Genetics 2019Quote: ... the C583Y mutation was introduced into the slc12a7a/kcc4a pXT7 construct using a QuikChange II Kit (Agilent) as per the manufacturer’s protocol.
-
bioRxiv - Biochemistry 2019Quote: The culture supernatants containing pre-NisA variants were analyzed by RP-HPLC (Agilent Technologies 1260 Infinity II). A LiChrospher WP 300 RP-18 end-capped column and an acetonitrile/water solvent system were used as described previously (Abts ...
-
bioRxiv - Biochemistry 2019Quote: ... For concentration determination the pre-NisA variants were analyzed by RP-HPLC (Agilent Technologies 1260 Infinity II) with a LiChrospher WP 300 RP-18 end-capped column and an acetonitrile/water solvent system as described previously (Abts ...
-
bioRxiv - Molecular Biology 2019Quote: ... Radioactive probes were synthesized using a Prime-It II Random Primer Labeling Kit (300385, Agilent Technologies, Inc).
-
bioRxiv - Microbiology 2020Quote: ... Two rounds of error-prone PCR were performed using the GeneMorph II Random Mutagenesis Kit (Agilent Technologies). The PCR product was cloned into the PADL22c vector and transformed via electroporation into the TG1 E ...
-
bioRxiv - Cancer Biology 2019Quote: ... the target region surrounding the expected mutation site was PCR amplified using Herculase II (600675, Agilent Technologies). PCR products were column-purified (Qiagen ...
-
bioRxiv - Genetics 2021Quote: ... Two oligos (F: GCGATGCCACCTAGGGCAAGCTGACCCTG and R: CAGGGTCAGCTTGCCCTAGGTGGCATCGC) were used with the QuikChange II mutagenesis kit (Agilent, 200523). We confirmed that this mutation (GFPstop ...
-
bioRxiv - Pathology 2020Quote: ... Site-directed mutagenesis was performed with the QuikChange® II XL Site-Directed Mutagenesis Kit (Agilent Technologies) and primers were designed using the QuikChange Primer Design tool (Agilent Technologies).
-
bioRxiv - Immunology 2020Quote: Viral mutants were generated by site-directed mutagenesis using the Quikchange II Site-directed mutagenesis kit (Agilent) with forward and reverse primers specific for each mutation (Key Resources Table) ...
-
bioRxiv - Genetics 2019Quote: ... The catalytically inactive point mutation C265S43 was introduced using the QuikChange II site-directed mutagenesis kit (Agilent) to create T7-DNMT3B2 catalytic dead (CD) ...
-
bioRxiv - Microbiology 2019Quote: ... point mutants were generated using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA), according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... These SNPs were made using the Quik Change II XL Site-Directed Mutagenesis Kit (Agilent Technology, 200521). The gRNA and c(3)GccΔ1 homologous repair template plasmid were sent to Genetivision (Houston ...
-
Gatekeeper helix activates Golgi SM protein Sly1 and directly mediates close-range vesicle tetheringbioRxiv - Cell Biology 2020Quote: ... a library of SLY1* mutant alleles was constructed using the GeneMorph II Random Mutagenesis Kit (Agilent #200550). The SLY1 open reading frame was amplified using the “medium mutation rate” PCR protocol ...
-
bioRxiv - Cell Biology 2019Quote: Generation of pGDB-SDEL plasmid was done using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) on the pGDB plasmid with primers P1 and P2 per the manufacturer’s protocol36.
-
bioRxiv - Biophysics 2019Quote: ... Point mutations were made using Quickchange II XL Site-Directed Mutagenesis kit (Agilent technologies, Santa Clara, CA). The sequences of the DNA constructs were confirmed by fluorescence-based DNA sequencing (Genewiz LLC ...
-
bioRxiv - Microbiology 2021Quote: ADAP1 and KRAS point mutants were generated using QuikChange II XL Site-Directed Mutagenesis kit (Agilent, 200522) per manufacturer’s instructions ...
-
Chemoproteomics of microbiota metabolites reveals small-molecule agonists for orphan receptor GPRC5AbioRxiv - Biochemistry 2021Quote: Chemicals and membrane-filtered bacterial cultures were analyzed by 1290 Infinity II LC/MSD system (Agilent technologies) using Poroshell 120 EC-C18 column (2.1 x 50 mm ...
-
bioRxiv - Microbiology 2020Quote: ... Mutations in the constructs were generated by standard mutagenic PCR using PfuUltra polymerase (QuikChange II; Agilent Technologies).
-
bioRxiv - Microbiology 2021Quote: ... Truncations were generated by stop codon insertion mutagenesis with QuikChange II XL mutagenesis kit (Agilent, cat# 200522), and GFP fusion expressing the STAT2 CC domain alone was constructed by PCR with specific primers to enable cloning into plasmid pEGFP-N1 or pEGFP-C1 ...
-
bioRxiv - Immunology 2022Quote: ... Solid phase extraction was performed on methanol and sodium acetate conditioned Bond Elut Certify II cartridges (Agilent). After loading the samples ...
-
bioRxiv - Biochemistry 2022Quote: ... which was labelled with alpha-32P-ATP using the Prime-It II Random Primer Labelling Kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... Each mutagenesis reaction was performed using QuikChange II Site-directed Mutagenesis kit (Agilent, Santa Clara, CA, USA) and the mixtures were made according to manufactures guidelines ...
-
bioRxiv - Biophysics 2022Quote: ... Site-directed mutagenesis were introduced into plasmids using QuikChange II XL site-directed mutagenesis kit (Agilent Technologies) and confirmed by Sanger sequencing.
-
bioRxiv - Cell Biology 2022Quote: ... We generated the 873-1159-Citrine ΔNLS mutant using site-directed mutagenesis (QuikChange II Kit, Agilent Technologies) using the distal plasmid as a template ...
-
bioRxiv - Immunology 2022Quote: ... Myc-NEU3 mutants were generated using a QuikChange II Site-Directed Mutagenesis Kit (Agilent, Santa Clara, CA) with the DNA oligomers GGGCCCCTTAAACCACTTATTGAATCCACACTACC for mutant 1 and CAGTTCACTTAGACTGGAAGATGAATCTGGAACAC for mutant 2 ...
-
bioRxiv - Microbiology 2022Quote: ... were generated using the QuikChange II XL site-directed mutagenesis kit according to the manufacturer’s instructions (Agilent). For expression of stabilized soluble S2P spike trimer proteins ...
-
bioRxiv - Microbiology 2022Quote: ... RH or IN-deleted constructs were created by invert PCR using Pfu II Taq polymerase (Agilent Technology) with deletion primers (Table S1) ...
-
bioRxiv - Microbiology 2022Quote: ... This was achieved by site-directed mutagenesis (QuikChange II Site Directed Mutagenesis Kit (Agilent, Santa Clara, CA)) using the primers EmaA-Pro-X-Gly-F and EmaA-Pro-X-Gly-R (Table 2 ...
-
bioRxiv - Pathology 2022Quote: ... The 15 μl of reactional mix were composed of 1x Brillant II qPCR master mix (Agilent Technologies), 0.03 μM ref dye provided with the master mix ...
-
bioRxiv - Neuroscience 2022Quote: ... The pT7-7 plasmid was also modified using site directed mutagenesis (#200523, QuikChange II, Agilent, Waldbronn, Germany) to incorporate a cysteine residue at position 141 to permit dye-labelling of the aSyn protein ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... qPCR was performed on a Stratagene 3000 qPCR system using Brilliant II SYBR Master Mix (Agilent – 600828). Primer sequences are in Supplementary Data 1 ...
-
bioRxiv - Neuroscience 2022Quote: ... The cDNA for E111V variant was obtained by PCR using QuikChange II Site-Directed Mutagenesis kit (Agilent) as described in ref ...
-
bioRxiv - Molecular Biology 2022Quote: ... at a concentration of 1.5 ng/µl using the eukaryote total RNA pico series II assay (Agilent) to assess RNA integrity ...