Labshake search
Citations for Agilent :
501 - 550 of 1491 citations for Urotensin II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... The adapter-ligated DNA fragments were amplified with Herculase II Fusion DNA Polymerase (Agilent). Finally ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... utilizing an Agilent 1260 Infinity II HPLC system (Agilent Technologies, Santa Clara, CA, USA). Metabolites were separated on a Phenomenex Kinetex PS C18 100A column (2.6 µm ...
-
bioRxiv - Microbiology 2024Quote: The smcR mutant alleles were created using GeneMorph II EZClone Domain Mutagenesis Kit (Stratagene) as per the company protocol targeting the smcR gene encoded on plasmid pJN22 ...
-
bioRxiv - Microbiology 2023Quote: UHPLC analysis was performed on an Agilent 1290 Infinity II (Agilent, Santa Clara, CA) equipped with a G4212A diode array detector ...
-
bioRxiv - Microbiology 2024Quote: ... USA) using a 1290 Infinity II UHPLC system (Agilent Technologies, Santa Clara, CA, USA). A sample injection volume of 1 μL was used throughout ...
-
bioRxiv - Biochemistry 2024Quote: All point mutations were generated using QuikChange II following the manufacturer’s instructions (Agilent, 200523).
-
bioRxiv - Cancer Biology 2024Quote: ... DNA fragments were amplified by PCR reaction (Pfu Ultra II fusion, Agilent Technologies, 600670), which also introduced the Illumina-P5 adapter at one end of the molecule ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Using an Agilent 1260 Infinity II HPLC system (Agilent Technologies, Santa Clara, CA, USA), PFAS metabolites were separated with a Phenomenex Kinetex PS C18 100A (2.6μm ...
-
bioRxiv - Genetics 2021Quote: ... while the longer “plasmid” PCR amplicons were generated using Herculase II Fusion DNA Polymerase (Agilent). Primer sequences used for chimeragenesis are listed in Table S8.
-
bioRxiv - Evolutionary Biology 2020Quote: ... labelled with [α-32P]-dCTP through the Prime-it II random primer labelling kit (Stratagene) was used ...
-
bioRxiv - Molecular Biology 2021Quote: ... The libraries were amplified with 7 PCR cycles using Herculase II Fusion Polymerase kit (Agilent). Libraries were next hybridized in the following way ...
-
bioRxiv - Cancer Biology 2019Quote: ... AGO2Y393F mutant construct was generated using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) from the FH-AGO2 plasmid described above using the primers hAGO2_Y393F_Fwd 5’AAATTCACGGACGAATGGATCTGTGTTGAAACTTGCAC3’ and hAGO2_Y393F_Rev 5’GTGCAAGTTTCAACACAGATCCATTCGTCCGTGAATTT3’ ...
-
bioRxiv - Biochemistry 2021Quote: ... pre-equilibrated with reconstitution buffer on an Agilent 1260 Infinity II LC system (Agilent Technologies) at 4°C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... with the following composition: 0.5 μL Herculase II fusion DNA polymerase (Agilent, Santa Clara CA) per 50 μL reaction ...
-
bioRxiv - Cell Biology 2020Quote: The doxycycline-inducible Tiam1-AA (non-βTRCP-binding) mutant was generated by Quikchange II (Agilent) site-directed mutagenesis of WT-Tiam1 mouse cDNA at S329 and S334 ...
-
bioRxiv - Developmental Biology 2021Quote: ... genomic sequences were amplified from wildtype DNA using Herculase II fusion DNA polymerase (Agilent Technologies). Sequence coordinates in GRCz10 and primers used for amplification are listed in Table S2 ...
-
bioRxiv - Bioengineering 2020Quote: ... The prepared samples were analyzed with high-performance liquid chromatography (HPLC; 1260 Infinity II; Agilent) equipped with DAD detectors (G7115A ...
-
bioRxiv - Neuroscience 2021Quote: ... The full construct was inserted into the multiple cloning site of pBluescript II SK (+) (Stratagene).
-
bioRxiv - Neuroscience 2021Quote: ... and PCR was set up with Brilliant II qPCR Low ROX Master Mix (Agilent Technologies). qPCR reaction and data were acquired on an Agilent Mx3005P qPCR System.
-
Scanning mutagenesis of RNA-binding protein ProQ reveals a quality control role for the Lon proteasebioRxiv - Microbiology 2021Quote: Libraries of ProQ mutants were generated by using GeneMorph II EZClone Domain Mutagenesis Kit (Agilent). As template ...
-
bioRxiv - Plant Biology 2020Quote: ... pDONR P2R-P3-PrKAI2d3 was mutated with the QuikChange II site directed mutagenesis kit (Agilent). The generated clones were checked by sequencing ...
-
bioRxiv - Plant Biology 2021Quote: ... The qRT-PCR was performed using the Brilliant II SYBR Green QPCR Master mix (Agilent) in real time PCR (Agilent Technologies ...
-
bioRxiv - Microbiology 2020Quote: ... The D614G mutation was introduced using the QuikChange II XL site-directed mutagenesis protocol (Stratagene). The presence of the desired mutations was determined by automated DNA sequencing ...
-
bioRxiv - Biochemistry 2021Quote: ... Site-directed mutagenesis was performed using the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene). All constructs were verified by sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... Mutant F14 expression vectors were constructed with QuikChange II XL Site-Directed Mutagenesis kit (Agilent), using primers containing the desired mutations and C-terminal TAP-tagged codon- optimised F14 cloned into pcDNA4/TO as template ...
-
bioRxiv - Microbiology 2021Quote: ... 120 μg of genomic DNA was amplified using DNA Herculase II Fusion DNA polymerase (Agilent) in the presence of 2% DMSO ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed using the PfuUltra II Fusion High-fidelity DNA polymerase (Agilent, California, USA) using genomic template DNA extracted using QuickExtract DNA extraction solution (Epicentre/ Lucigen ...
-
bioRxiv - Microbiology 2020Quote: ... Viral cDNA was amplified by PCR using the Herculase II polymerase (Agilent, Santa Clara, CA) and amplified viral cDNA was gel purified using a Spin Gel Purification kit (Qiagen) ...
-
bioRxiv - Neuroscience 2021Quote: Site directed mutagenesis was performed using the QuikChange II XL site-directed mutagenesis kits (Stratagene) or the Q5® Site-Directed Mutagenesis kit (NEB ...
-
bioRxiv - Cell Biology 2021Quote: ... and was analyzed by qPCR using the Brilliant II SYBR Green QPCR Master Mix (Agilent Technologies ...
-
bioRxiv - Biophysics 2020Quote: ... Mutagenesis of of tubbyCT was done using QuikChange II XL Site-Directed mutagenesis kit (Stratagene, Agilent Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... was generated by site-directed mutagenesis (QuikChange II XL Site-Directed Mutagenesis Kit, Agilent Technologies) with three subsequent rounds of PCR using the following primers ...
-
bioRxiv - Biochemistry 2022Quote: ... Point mutants were introduced using whole plasmid amplification with Pfu Ultra II (Agilent, 600670-61) and complementary primers ...
-
bioRxiv - Molecular Biology 2022Quote: In-vitro mutagenesis by PCR-mediated recombination QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) was performed using the cDNA of human GPRC6A cloned in the vector pcDNA3 (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: ... The gradient was delivered by the 1290 Infinity II LC System (Agilent Technologies, Waldbronn, Germany) at a flow rate 40 μL·min−1 ...
-
bioRxiv - Biochemistry 2020Quote: ... ACS variants were generated via site-directed mutagenesis using a QuikChange II kit from Agilent Technologies ...
-
Cryo-EM structure of a eukaryotic zinc transporter at a low pH suggests its Zn2+-releasing mechanismbioRxiv - Biochemistry 2022Quote: ... Mutations were introduced by site-directed mutagenesis using QuikChange II system (Agilent, Santa Clara, CA) according to manufacturer’s recommendation ...
-
bioRxiv - Microbiology 2019Quote: Site-directed mutagenesis was carried out using a QuikChange II Site-Directed Mutagenesis Kit (Stratagene, Agilent Technologies ...
-
bioRxiv - Biophysics 2019Quote: ... deletions and substitutions were generated using the QuikChange II Site-Directed Mutagenesis kit (Agilent Technologies), and confirmed by DNA sequencing (GENEWIZ ...
-
bioRxiv - Immunology 2019Quote: ... we used the following mutagenesis primers using the QuikChange II Site-Directed Mutagenesis Kit (Agilent); F ...
-
bioRxiv - Biochemistry 2019Quote: ... All site-directed mutagenesis was performed using the QuikChange II Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Microbiology 2019Quote: ... The described deletions were performed using the QuikChange II Site-Directed Mutagenesis kit (Agilent Technologies).
-
bioRxiv - Cell Biology 2019Quote: ... we used Roche’s LightCycler and Brilliant II SYBR® Green QRT-PCR Master Mix (Agilent).
-
bioRxiv - Cancer Biology 2020Quote: ... This was carried out using the QuickChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies) according to the manufacturer’s protocol with the following exception ...
-
bioRxiv - Microbiology 2020Quote: ... the samples were analyzed sequentially with an UHPLC (Agilent 1290 II Infinity, Agilent Technologies, USA) coupled to an IM-QTOF mass spectrometer (Agilent 6560 IM-QTOF ...
-
bioRxiv - Neuroscience 2019Quote: ... we generated a single nucleotide exchange using the QuikChange II Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Plant Biology 2020Quote: ... Mutant F161A was made using the Quick-Change II-E site-directed mutagenesis kit (Stratagene) and a pair of complementary primers (Supplementary Table S1) ...
-
bioRxiv - Cell Biology 2019Quote: ... K-R mutant plasmids were generated using Quikchange II XL site-directed mutagenesis kit (Agilent), with primers listed in Table S5 ...
-
bioRxiv - Molecular Biology 2020Quote: The two linkers were optimized separately using Quikchange II site-directed mutagenesis Lightening kit (Agilent) with customized primers ...
-
bioRxiv - Microbiology 2020Quote: ... gel purified and labeled with Random Prime it-II kit using 32p-dCTP (Agilent Technologies).