Labshake search
Citations for Agilent :
901 - 950 of 1491 citations for Urotensin II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... and a 1500-bp downstream segment of LBDG_02920 fragments in this order and then cloned into a 1752-bp segment derived from pBluescript II SK(+) (Stratagene) to give rise to pIL910 ...
-
bioRxiv - Plant Biology 2022Quote: ... Site-directed mutagenesis of pH4::H4 in pENTR/D using QuikChange II XL (Agilent Technologies, Santa Clara, CA, USA) was first performed to create plasmids with 10 silent mutations in the H4 coding sequence ...
-
bioRxiv - Cancer Biology 2022Quote: ... Site directed mutagenesis was performed following the manufacturer’s protocol using the Quick-Change II site-directed mutagenesis kit (Agilent Technologies ...
-
bioRxiv - Biophysics 2022Quote: Site-directed mutagenesis of the human yb-1 coding gene was carried out directly on the pET22b-YB-1_1-180 expression plasmid by using the “Quikchange II XL site-directed mutagenesis kit” from Stratagene and appropriate oligonucleotides (Eurofins Genomics) ...
-
bioRxiv - Biophysics 2022Quote: ... G553I) variant were cloned using the QuikChange II Site-Directed Mutagenesis Kit according to manufacturer’s instructions (Agilent Technologies, #200523). All plasmids were sequenced to confirm the correct sequences (Genewiz).
-
bioRxiv - Microbiology 2021Quote: Plasmids encoding the single-mutation variants found in P.1 and 10-mutation variant (BZΔ10) were generated by Quikchange II XL site-directed mutagenesis kit (Agilent). Recombinant Indiana VSV (rVSV ...
-
bioRxiv - Microbiology 2021Quote: ... Cassettes and the template plasmid pM07704 were amplified by polymerase chain reaction (PCR) with Herculase II DNA polymerase (Stratagene). Marker-exchange plasmids were generated by ligation of the PCR products in α-select cells (Bioline ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... We produced the promoter inserts by performing error-prone PCR using the GeneMorph II Random Mutagenesis Kit (Agilent Technologies). We used 25 ng of the plasmid construct with the MG1655 lacZ promoter variant cloned into it as a template DNA for the error-prone PCR to achieve approximately 1.5 SNPs per variant sequence ...
-
bioRxiv - Cancer Biology 2019Quote: ... The pBabe-KRAS point mutation Q61H was created by using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) following the recommended protocol ...
-
bioRxiv - Microbiology 2019Quote: ... Pair1 and Rejoin1 mutations were introduced using the site-directed mutagenesis commercial kit QuickChange® II XL (Agilent, CA) according to the manufacture’s protocol ...
-
bioRxiv - Plant Biology 2019Quote: ... The Msrab11f1(S29N) mutant was generated using QuikChange II Site-Directed Mutagenesis Kits performed according to the manufacturer’s manual (Stratagene) with the primers CTGGAGTTGGGAAAAACAATCTGCTTTCAAGG ...
-
bioRxiv - Neuroscience 2019Quote: ... Extracted RNA genomes were converted to complementary DNA using an AccuScript PfuUltra II RT-PCR kit (Agilent Technologies, USA) at 42°C for 2 hours with the following barcoded primer annealing to the rabies virus leader sequence ...
-
bioRxiv - Cell Biology 2019Quote: Methionine153 on pHluorin in pcDNA3.1-pHluorin-CD6320 was mutated to Arginine using QuickChange II XL Site-Directed Mutagenesis Kit (Agilent) with a pair of primers (Forward ...
-
bioRxiv - Microbiology 2019Quote: ... The analysis of violacein were performed on high-performance liquid chromatography (HPLC) (Agilent Technologies 1220 Infinity II LC, USA) using Agilent Eclipse Plus C18 column (4.6*100 mm ...
-
bioRxiv - Cell Biology 2019Quote: ... The qPCR reaction was performed using Roche’s LightCycler and Brilliant II SYBR® Green QRT-PCR Master Mix (Agilent). We analyzed enrichment for target histone modifications by amplifying unique DNA barcodes at the 3’ end ...
-
bioRxiv - Cancer Biology 2019Quote: ... Mutant ORFs (FGFR2 M538I, N550K and K660N) were made using QuickChange II site-directed mutagenesis kit (Agilent Technologies #200523). Most stable cells lines express ORFs in pLX317 vector and were selected with puromycin (Life Technologies #A1113803) ...
-
bioRxiv - Immunology 2020Quote: ... and subsequently mutagenized by error-prone PCR (ePCR) via the GeneMorph II Random Mutagenesis Kit (Agilent Technologies, Cat # 200550) with a target nucleotide mutation frequency of 0–4.5 mutations per kilobase of DNA ...
-
bioRxiv - Pathology 2021Quote: ... The region containing random fragments of the VWF plasmid was made double stranded using primers P9/P10 (annealing temperature = 65.0°C) and Herculase II (Agilent) with 16-20 rounds of PCR amplification (Figure S1B) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The miR159 recognition site was altered by directed mutagenesis using a QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies); the amino acid sequence was not changed ...
-
bioRxiv - Microbiology 2020Quote: ... Abundances of bacterial 16S rRNA genes were determined by quantitative PCR using Brilliant SYBR Green II Mastermix (Agilent Technologies) on a Mx3000P system (Agilent Technologies ...
-
bioRxiv - Genetics 2019Quote: ... Serine-to-alanine mutation was generated using QuikChange II XL Site-directed Mutagenesis Kit (Agilent Technologies, CA, USA 200522) following manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... and AFF4 NM_014423.4:c.772C>T mutations were engineered using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... and S311A mutations were introduced by site directed mutagenesis using the QuikChange II Site-directed mutagenesis kit (Agilent #200521) and the following primers:
-
bioRxiv - Biophysics 2020Quote: ... Mutagenesis of of tubbyCT was done using QuikChange II XL Site-Directed mutagenesis kit (Stratagene, Agilent Technologies, Waldbronn, Germany).
-
bioRxiv - Microbiology 2020Quote: ... Site-directed mutagenesis of plasmids was performed by DNA synthesis with 2.5 U PfuUltra II Fusion HS DNA Polymerase (Agilent), 0.2 μM oligonucleotide encoding the change ...
-
bioRxiv - Microbiology 2020Quote: The plasmid HIV-1ΔEnv INHA (D116A)ΔNef was obtained by insertional mutagenesis using the QuikChange II XL Site-Directed Mutagenesis kit (Agilent). HIV-1 viruses were produced by cotransfection with calcium phosphate with 10 μg HIV-1 LAI (BRU ...
-
bioRxiv - Immunology 2021Quote: ... The site directed mutagenesis was conducted with QuikChange II Site-Directed Mutagenesis Kit (Agilent, Santa Clara, CA, United States) in accordance with the manufactur’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... in dH2O and analyzed by UPLC-MS (Agilent Technologies 1290 Infinity II UPLC system coupled online to an Agilent Technologies 6120 Quadrupole LC/MS spectrometry in negative electrospray mode ...
-
bioRxiv - Immunology 2020Quote: Point mutations by site-directed mutagenesis were introduced in env constructs using the QuikChange II kit (Agilent Technologies Inc.) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... The catalytically inactive ATGL(S47A) mutant was was made by site directed mutagenesis using the QuickChange II kit (Stratagene). PLIN2-GFP was a generous gift from Carole Sztalryd (University of Maryland) ...
-
bioRxiv - Genetics 2019Quote: ... Single base-pair SMD-CRD missense variants were then introduced using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent, Cat # 200521 ...
-
bioRxiv - Genomics 2021Quote: PCR was performed from each DNA sample for four regions (ORF21, ORF34, ORF46, and ORF18) using Herculase II (Agilent). Each region was then PCR purified (GeneJet ...
-
bioRxiv - Microbiology 2022Quote: ... and ethanol) was measured by HPLC using a 1260 Infinity II LC System with a Refractive Index Detector (Agilent). A 300×7.8 mm Hi-Plex HPLC Column (Agilent ...
-
bioRxiv - Cancer Biology 2022Quote: ... PLK1 mutant plasmids were generated using specific primers (sequences available upon request) following the manufacturer’s instructions (QuickChange II, Stratagene). shPLK1 UTR ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The resulting two vectors were then subjected to site-directed mutagenesis (QuickChange II XL Site-Directed Mutagenesis Kit; Agilent Technologies ...
-
bioRxiv - Microbiology 2022Quote: SARS-CoV-2 Mpro mutants were generated with QuikChange® II Site-Directed Mutagenesis Kit from Agilent (Catalog #200524), using plasmid pE-SUMO-Mpro as the template ...
-
bioRxiv - Molecular Biology 2023Quote: ... megaprimers were synthesized and cloned into the TFAM-mScarlet_pWPXL plasmid following the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) large insertion protocol ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Concentrations of metabolites in the fed-batch samples were measured via the 1260 Infinity II LC system from Agilent equipped with an Hi-Plex 7.7 × 300 mm ...
-
bioRxiv - Immunology 2023Quote: ... we substituted in the VH domain the serine at position 120 to an unpaired cysteine (14.4.4 scFV) via site directed mutagenesis (QuikChange II, Agilent technologies). In addition ...
-
bioRxiv - Molecular Biology 2023Quote: ... and pGEX2T-FRs variant mutants were generated by site-directed mutagenesis using QuikChange II XL Site-directed mutagenesis (Agilent) with primers listed in the Appendix table and subsequently validated by Sanger sequencing ...
-
bioRxiv - Molecular Biology 2023Quote: All mutagenesis reactions were carried out using the QuikChange II Site-Directed or Lightning MultiSite-Directed Mutagenesis Kits (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: ... SIK3-Flag-S884A and S884D plasmids were generated by introducing site-directed mutations into SIK3-Flag plasmid using the QuikChange II XL site-directed mutagenesis kit according to manufacturer’s instruction (Agilent). Lenti-Puro-SIK3-Flag plasmid was constructed by subcloning the “mSIK3-3xFlag” coding sequences (CDS ...
-
bioRxiv - Immunology 2023Quote: ... site-directed mutagenesis using specific primers was performed based on the QuikChange site-directed mutagenesis Kit II (Agilent Technologies) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: EEF1A2 mutations in both the CMV-NGFP-EEF1A2-Neo vector and the pcDNA3.1-CMV-Flag-EEF1A2 vector were generated using the QuikChange II site directed mutagenesis kit (Agilent) according to the manufacturers protocol using the following primers.
-
bioRxiv - Neuroscience 2023Quote: ... nucleotides 214–990) was amplified by PCR and cloned into the pBluscript II KS (−) plasmid (Stratagene, La Jolla, CA). Antisense RNAs were synthesized from linearized plasmids using T3 RNA polymerase (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: ... vRNA and gDNA were both amplified by PCR using R1_forward primer and R1_Reverse primer using Herculase II Fusion DNA Polymerase (Agilent, 600677). PCR products were cleaned up using the QIAquick PCR clean up kit (Qiagen ...
-
bioRxiv - Genetics 2023Quote: ... The PCR amplifications were performed with Herculase II fusión DNA Polymerase following supplier recommendation (Agilent, Santa Clara, CA, USA).
-
bioRxiv - Cancer Biology 2023Quote: ... 2.2 kb) 20 was labelled by [a-32P]-dCTP by Prime-It II Random Primer Labeling Kit (Agilent Technologies) and hybridized with Hybond-N ...
-
bioRxiv - Biophysics 2023Quote: ... A non-cleavable T855G mutant of this Lphn3 GAIN domain fusion protein was generated using QuikChange II XL (Agilent) site-directed mutagenesis with primers 5’-ATG CAG CTG TAA TCA CCT GGG CAA CTT TGC TGT CCT GAT G -3’ and 5’-CAT CAG GAC AGC AAA GTT GCC CAG GTG ATT ACA GCT GCA T -3’.
-
bioRxiv - Biochemistry 2022Quote: AtCOSY mutants were generated according to the protocol described in the QuickChange II Site-Directed Mutagenesis Kit (Agilent Technologies) using plasmid pHis8-4b::AtCOSY as the template and the primer sequences in Supplementary Table 5 ...