Labshake search
Citations for Agilent :
5601 - 5650 of 6604 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... UHOR_02675 active site mutants (Ribo1-ME80Q/D98N) were created from by using QuickChange XL Site-Directed Mutagenesis Kit from Agilent Technology according to manufactures instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and run on the Agilent 2100 Bioanalyzer using the Agilent High Sensitivity DNA Kit (Agilent Technologies, Santa Clara CA, USA) to confirm amplicon length and purity ...
-
bioRxiv - Microbiology 2024Quote: ... TamA G271C and G574C substitutions were introduced into pXW48 using the QuikChange Site-Drected Mutagenesis Kit (Agilent catalog number 200524). Plasmids that encode bamABCDE8His-bamB (pYG120 ...
-
bioRxiv - Plant Biology 2024Quote: ... RNA quantity and quality were determined using the Agilent RNA 6000 Pico Kit with Bioanalyzer 2100 system (Agilent Technologies, USA). Samples with high purity and RNA Integrity Number (RIN ...
-
bioRxiv - Plant Biology 2024Quote: ... and the quality of RNA based on the RNA Integrity Number was estimated using either the 2100 BioAnalyzer (Cat no: G2939BA; RNA 6000 Nano Kit; Cat no: 5067-1511. Agilent), 5200 Fragment Analyzer (Cat no ...
-
bioRxiv - Plant Biology 2024Quote: ... The quality of the adapter-ligated libraries was checked on the BioAnalyzer High Sensitivity DNA kit (Cat no: 5067-4626. Agilent) or Caliper GX LabChip GX/HT DNA high sensitivity kit (Cat no ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... from these samples (muscle or blood) using Qiagen MagAttract HMW DNA Kit and checked the DNA quality using TapeStation (Agilent), Qubit ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Final library quality was determined by Bioanalyzer 2100 using the Agilent High Sensitivity DNA Kit (Agilent, Cat. No. 5067-4626) and pooled together after normalizing samples based on their quantity from qPCR ...
-
bioRxiv - Developmental Biology 2024Quote: Site-directed mutagenesis of Branchiostoma floridae Pax6 cDNA cloned in pKW mammalian expression vector was performed by the Quick-Change kit (Stratagene) using primers zk2027A/zk2027B to generate Pax6ΔQL ...
-
bioRxiv - Developmental Biology 2024Quote: Donor plasmid PAM sites were mutated using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA). The gRNA-encoding plasmids pU6-BbsI-chiRNA-RhoGEF2 and pU6-BbsI-chiRNA-Cysts were made by insertion of gRNA oligos into pU6-BbsI-chiRNA (Addgene #45946 ...
-
bioRxiv - Biochemistry 2024Quote: The expression vector encoding His-tagged SpNOXDH - aa 181-417 of full-length SpNOX - was obtained from SpNOX by site-directed mutagenesis according to the manufacturer’s protocol (QuikChange® Lightning Site-Directed Mutagenesis Kit, Agilent), using forward primer 5’GTCTGGTCCCGCGTGGCAGTAAAATTAGCTTTCCGTATCTGGG3’ and reverse primer 5’CCCAGATACGGAAAGCTAATTTTACTGCCACGCGGGACCAGAC3’ ...
-
bioRxiv - Microbiology 2024Quote: ... Library quality was assessed using High Sensitivity D1000 kit on a 4200 TapeStation instrument (Agilent Technologies, Santa Clara, CA, USA). The NovaSeq Sequencing System (Illumina ...
-
bioRxiv - Cell Biology 2024Quote: ... RNA quality was checked using a 2100 Bioanalyzer with the RNA 6000 Nano kit (Agilent Technologies, Santa Clara, CA, USA). DNA libraries suitable for sequencing were prepared from 10 ng of DNase-treated total RNA ...
-
bioRxiv - Microbiology 2024Quote: ... The integrity of the RNAs was verified using the Agilent 2100 bioanalyzer with the RNA 6000 Nano kit (Agilent Technologies). RT-pPCR experiments and data analysis were performed as described (19) ...
-
bioRxiv - Genetics 2024Quote: ... The BP-lowering rs1173771 haplotype was then constructed by site directed mutagenesis at the 11 SNPs locations in the haplotype using QuikChange II Site-directed mutagenesis kit (Agilent) and confirmed by Sanger sequencing ...
-
bioRxiv - Immunology 2024Quote: ... The glycolytic function of infected macrophage was analyzed by the Agilent Seahorse XF Glycolytic Stress Test Kit (Agilent, 103020-100). Mφs and amastigotes were distributed in Seahorse XF96 tissue culture microplates for 3 days at 34°C ...
-
bioRxiv - Biochemistry 2024Quote: ... were introduced into all TE expression plasmids in place of codons for the catalytic Ser or Cys residues using the QuikChange XL Site-Directed Mutagenesis kit (Agilent), optimized for GC-rich sequences (JuvEV TE S1637amb ...
-
bioRxiv - Biochemistry 2024Quote: The plasmid for expression of the rare codon reporter pCIneo-RLuc (30xRC) was generated by site-directed mutagenesis using the QuikChange Site-Directed Mutagenesis kit (Stratagene). Protein mutant plasmids used in this study are listed in Supplementary Table S1 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and the mean fragment size was assessed using the DNA High Sensitivity KIT on a 2100 Bioanalyzer (Agilent Technologies, Netherlands). 4 nM pooled libraries was sequenced on NovaSeq S1 flow cell by Livestock Improvement Corporation Ltd ...
-
bioRxiv - Immunology 2024Quote: ... From this construct, CDC42 point mutants (R186C, C188Y, Y64C) were obtained by site-directed mutagenesis (Quick change kit, Agilent Technologies). The *192C*24 plasmid was produced by ThermoFisher.
-
bioRxiv - Cell Biology 2024Quote: ... The library profiles were checked using High Sensitivity NGS Fragment Analysis kit (1-6000bp) (Agilent Technologies, reference DNF-474-1000) on the 5300 Fragment Analyzer System ...
-
bioRxiv - Cell Biology 2024Quote: ... Qualitative and quantitative measurement of cDNA was conducted with the High Sensitivity NGS Fragment 1-6000bp kit on a 48-channel Fragment Analyzer (Agilent) and 1x dsDNA kit on the Qubit 4 Fluorometer (ThermoFisher) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Different phosphorylation state isoforms for phf10 mRNA were generated by site-directed mutagenesis using QuikChange Multi Site-Directed Mutagenesis kit (#200514, Agilent), following manufacturer’s instructions and specific primers (Supp ...
-
bioRxiv - Genetics 2023Quote: ... ND-1000 UV-visible light spectrophotometer (Nanodrop Technologies) and Bioanalyzer 2100 with the RNA 6000 Nano Lab Chip kit (Agilent) was used to assess the concentration and integrity of RNA.
-
bioRxiv - Immunology 2024Quote: ... The libraries were analyzed for size distribution and concentration using BioAnalyzer High Sensitivity DNA kit (Agilent Technologies, Santa Clara, CA). Libraries were pooled at equimolar concentrations and sequenced on Novaseq6000 (Illumina ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then single indexed libraries were prepared using Agilent Sure-Select methodology (XT-HS kit, Agilent, Santa Clara, CA, US). The libraries (some pooled ...
-
bioRxiv - Molecular Biology 2024Quote: The CtIP-S276A variant was prepared by mutating the respective wild-type pFB-2xMBP-CtIP-10xhis plasmid by QuickChange site-directed mutagenesis kit following manufacturer’s instructions (Agilent Technology). The wild-type protein ...
-
bioRxiv - Cancer Biology 2024Quote: ... OCR and ECAR were measured using the Agilent XFe96 Extracellular Flux Analyzer and the XF Glycolysis Stress Test Kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... We generated additional LRRK2 variants using the QuikChange Lightning Site-Directed Mutagenesis Kit as per the manufacturer’s instructions (Agilent, #210518).
-
bioRxiv - Molecular Biology 2024Quote: ... sequence was introduced between sequences for residues 148 and 149 in KCNQ1 extracellular S1–S2 loop using QuikChange Lightning Site-Directed Mutagenesis kit (Stratagene) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... The internal reference masses of 121.050873 m/z and 922.009798 m/z (G1969-85001 ES-TOF Reference Mass Solution Kit, Agilent Technologies & Supelco) were used for all analyses of the samples ...
-
bioRxiv - Developmental Biology 2024Quote: ... High-fidelity version of RfxCas13d (Hf-RfxCas13d) was generated by site-directed mutagenesis using QuikChange Multi Site-Directed Mutagenesis kit (Agilent), following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... a purified plasmid encoding PB1177:385 was used as a template with the GeneMorph II Random Mutagenesis kit (Agilent, #200550) in an error-prone PCR ...
-
bioRxiv - Biochemistry 2024Quote: ... site-directed mutagenesis was performed according to the protocol described in the QuickChange II Site-Directed Mutagenesis Kit (Agilent Technologies) using plasmid pHis8-4b::McDAH as the template and the primer sequences in Supplementary Table 9 ...
-
bioRxiv - Genomics 2024Quote: ... Average fragment lengths were determined using the Femto Pulse system with the Genomic DNA 165kb Analysis Kit (FP-1002-0275, Agilent).
-
bioRxiv - Immunology 2024Quote: ... cDNA and libraries were made using the Lexogen QuantSeq 3’ mRNA-seq FWD library prep kit and quality was assessed by Agilent High Sensitivity DNA kit on a Bioanalyzer (Agilent) ...
-
bioRxiv - Immunology 2024Quote: ... The total RNA quality and quantity were analysis of Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit (Agilent, CA, USA) with RIN number >7.0 ...
-
bioRxiv - Microbiology 2024Quote: ... PolyA tailing of RNA and cDNA synthesis was carried out using the miRNA 1st-Strand cDNA Synthesis Kit (Agilent Technologies) according to the manufacturer’s instructions and SuperScript TM III (Invitrogen 18080044) ...
-
bioRxiv - Microbiology 2024Quote: ... the dual mutations C133S/T135S was introduced to the HP1α CSD (aa 112-176) using the QuikChange Mutagenesis Kit (Stratagene). HP1α was expressed and purified as described above ...
-
bioRxiv - Immunology 2024Quote: ... Eluted cDNA was assessed for quality and quantified with the Agilent High Sensitivity DNA Kit and using a Bioananlyzer 2100 (Agilent) instrument ...
-
bioRxiv - Genetics 2024Quote: ... RNA concentration and purity was measured on a Nanodrop and with Agilent RNA 6000 Nano Kit (Agilent Technologies, 5067-1511) on Agilent 2100 Bioanalyzer ...
-
bioRxiv - Immunology 2024Quote: ... cDNA was stored for a maximum of 4 weeks at –20°C before making the libraries and concentration was assessed using a Bioanalyzer High Sensitivity DNA Kit on a 2100 Bioanalyzer (Agilent). To generate libraries ...
-
bioRxiv - Immunology 2024Quote: ... A mitochondrial stress test assay on the XF-HS Mini was optimized within the ranges provided by the manufacturer and performed using the Mitochondrial Stress Test kit (Agilent). In-well concentrations for each drug at the time of injection were Oligomycin (1.5 μM) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Key parameters of mitochondrial respiration were measured by applying Seahorse XF Cell Mito Stress Test Kit (#103015-100, Agilent Technologies), which is a set of oligomycin ...
-
bioRxiv - Molecular Biology 2024Quote: ... Each sample was quantified with the Quant-iT Qubit dsDNA HS kit and the library size distribution was confirmed by Agilent TapeStation (HS DNA 1000).
-
bioRxiv - Molecular Biology 2024Quote: ... Fragmentation of chromatin to an average size of 200-500bp was checked on Agilent 2100 Bioanalyzer using High Sensitivity DNA Kit (Agilent). Samples were then diluted by adding 1 volume of equilibration buffer ...
-
bioRxiv - Zoology 2024Quote: ... The quality of extracted DNA was checked on the Agilent 2100 Bioanalyzer by the High Sensitivity DNA kit (Agilent, US). Because DNA was already fragmented to 50-200 bp fragments ...
-
bioRxiv - Immunology 2024Quote: ... OCR and ECAR were analyzed using a Seahorse XFp Cell Mito Stress Test kit (Agilent Technologies, Santa Clara, CA, USA). All assays were performed according to manufacturer instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... The resulting libraries tagged with unique dual indices were checked for size and quality using the Agilent High Sensitivity DNA Kit (Agilent). Library concentrations were measured using the KAPA SYBR Fast qPCR kit (Roche ...
-
bioRxiv - Cancer Biology 2024Quote: ... The quality control and the fragment size distribution were determined using the DNF-474 High sensitivity NGS kit on a Fragment analyzer (Agilent).