Labshake search
Citations for Agilent :
5551 - 5600 of 6604 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... Mutations into the TMD were introduced by site-directed mutagenesis using the Quick Change II kit following the manufacturer’s instructions (Agilent Technologies). All DNA manipulations were confirmed by the sequencing of plasmid DNAs (Macrogen Spain) ...
-
bioRxiv - Biochemistry 2022Quote: ... Site-directed mutagenesis of POLID was performed on pTOPO-FLID-WT using the QuikChange Multi Site-Directed Mutagenesis Kit (Agilent) with primers POLID M1 and POLID M2 to generate pTOPO-FLID-Poldead ...
-
bioRxiv - Cell Biology 2022Quote: ... The stop codon between MYO10 and BioID was then replaced with a codon encoding valine (GTA) using a quick-change mutagenesis kit from Agilent and following the manufacturers’ instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... sor1-D303A and sor1-Y305A variants proteins) were introduced into the cloned sor1 gene using the QuikChangeII kit (Agilent Technologies) and inserted into the genome by transformation.
-
bioRxiv - Cell Biology 2022Quote: ... The recombinant pET30a-hOGG1 was used as a template to introduce Y203A and N149A/N150A (referred to as 2NA) substitutions using the Quick-Change kit (Agilent) using primers indicated in Table S2 ...
-
bioRxiv - Cell Biology 2022Quote: ... losing nuclear localization was generated by mutating the lysine residues at 472 and 473 to alanine residues (KK472/473AA) via the QuickChange site-directed mutagenesis kit (Stratagene). The same approach was used to generate tyrosine phospho-defective PFKFB3 at the indicated residues by replacing tyrosine with phenylalanine ...
-
SMDT1 variants impair EMRE-mediated mitochondrial calcium uptake in patients with muscle involvementbioRxiv - Genetics 2022Quote: ... exome enrichment was performed using the SureSelect Human All Exon 50 Mb Kit V5 (Agilent Technologies, Santa Clara, CA, USA). Sequencing was done on a HiSeq4000 (Illumina ...
-
Species-specific protein-protein interactions govern the humanization of the 20S proteasome in yeastbioRxiv - Genetics 2022Quote: The PSMB7 mutant gene library was previously generated (Kachroo et al, 2015) by error-prone PCR (GeneMorph II Random Mutagenesis Kit from Agilent) to introduce mutations and add attL1 and attL2 sites at the 5’ and 3’ ends of the gene (Reece-Hoyes & Walhout ...
-
bioRxiv - Genomics 2022Quote: ... RNA quality was assessed by resolving the 18S and 28S ribosomal RNA bands using the Agilent 2100 Bioanalyzer and the RNA 6000 Nano kit (Agilent). RNA-seq libraries were constructed using TruSeq Stranded Total RNA sample prep kit (Illumina) ...
-
bioRxiv - Genetics 2022Quote: ... ADAR1 point mutations were generated based on the ADAR1p150 sequence using the QuickChange II XL site-directed mutagenesis kit (Agilent). The doxycycline-inducible MDA5 construct was generated by replacing dCas9 with MDA5 CDS in the HR-TRE3G-dCas9-GCN4-10x-p2a-mCherry backbone ...
-
bioRxiv - Immunology 2022Quote: ... The SCIV construct was then used to create allelic variants at position 375 using the QuikChange II XL site-directed mutagenesis kit (Agilent). Wild-type and mutant plasmids were transformed into MAX Efficiency Stbl2 competent cells (ThermoFisher Scientific ...
-
bioRxiv - Genetics 2022Quote: ... The integrity of the HMW gDNA was verified on the Femto Pulse system using the Genomic DNA 165 kb Kit (Agilent Technologies ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Genetics 2022Quote: ... the other mtr4 mutant plasmids were constructed by site-directed mutagenesis of the MTR4 HIS CEN6 plasmid (pAC4096) with the QuikChange II Site-Directed Mutagenesis Kit (Agilent) and oligonucleotides containing the corresponding missense mutations ...
-
bioRxiv - Microbiology 2022Quote: ... Quality assessment and library size estimation of the individual libraries was done using an HS DNA kit (Agilent, #5067-4626) in a Bio analyzer 2100 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 ng of extracted PCR products were analyzed by an Agilent High Sensitivity DNA kit on an Agilent 2100 Bioanalyzer (Agilent), and the remainder was cloned by using PCR Cloning Kit (New England Biolabs ...
-
bioRxiv - Microbiology 2022Quote: ... The RNA quality was assessed using the Agilent 2100 Bioanalyzer using RNA 6000 Pico kit (Agilent Technologies, Santa Clara, CA). qRT-PCR probe and primer sets (Table S2 ...
-
bioRxiv - Plant Biology 2022Quote: ... the concentration and fragment sizes of the DNA libraries were evaluated using the TapeStation 4200 kit (Agilent Technologies, United States) and the High Sensitivity D1000 kit.
-
bioRxiv - Molecular Biology 2023Quote: ... Site-directed mutagenesis was used to introduce mutations into the putative miR-423-5p binding sites on the Cacna2d2 3’UTR using the QuickChange II XL site-direct mutagenesis kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA integrity (RIN R 8.0) was confirmed using the High Sensitivity RNA Analysis Kit (DNF-472-0500, Agilent formerly AATI) on a 12-Capillary Fragment Analyzer ...
-
bioRxiv - Neuroscience 2023Quote: ... Amplified DNA from F1 mutants was used for cloning with the StrataClone PCR Cloning Kit (Agilent; Santa Clara, CA, USA) and then transformed with StrataClone SoloPack (Agilent ...
-
bioRxiv - Immunology 2022Quote: ... Quality check was performed with the Bioanalyzer 2100 using the Agilent High Sensitivity DNA Kit (both Agilent, Santa Clara, USA). Pooled sequencing-ready libraries of the WTA and sample tag were sequenced on Illumina NovaSeq 6000 (150 bp ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... We extracted RNA using the Qiagen RNeasy Blood and Tissue Kit and checked RNA integrity with a TapeStation 2200 (Agilent). Only two samples had RNA integrity numbers (RIN ...
-
bioRxiv - Biochemistry 2022Quote: ... The N165A and N234A variants of HDM-SARS2-S-del21-D614G were generated by site-directed PCR mutagenesis using the QuickChange II kit (Agilent), and changes were confirmed by sequencing ...
-
bioRxiv - Genetics 2023Quote: ... and the point mutations in the PWWP domain of DNMT3B (W263A, D266A, S270P, K276E and K294E) were introduced using the QuikChange II site-directed mutagenesis kit (Agilent). DNMT3BΔN starts from M200 and was generated by PCR ...
-
bioRxiv - Genomics 2023Quote: ... R838W and F867L Ephb4 mutations were introduced by site-directed mutagenesis using a QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... exome capture was performed on 200 ng DNA using a customised version of the Agilent Human All Exome V5 Kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... The pcDNA3.1 ERG (GenBank accession. NM_182918) Myc-tagged construct was mutated using the QuickChange Lightning Multi SiteDirected Mutagenesis kit (Agilent: #210513). All primers were designed using the QuickChange Primer Design Program (Agilent ...
-
bioRxiv - Cancer Biology 2023Quote: Whole genome paired-end sequencing was performed using the Agilent SureSelect v3 library preparation kit (Agilent Technologies, Santa Clara, CA). Paired-end 150 base pair reads were generated using an Illumina HiSeq 2500 sequencing instrument ...
-
bioRxiv - Cell Biology 2023Quote: ... and Pst I restriction sites of the multiple cloning site of pEGFP-Mieap were introduced using QuikChange Site-Directed Mutagenesis Kits (Agilent) with primers Mut-F1 ...
-
bioRxiv - Cell Biology 2022Quote: Mitochondrial ATP-linked respiration and extra cellular acidification rate was measured by the Seahorse XFe96 Analyzer using the Mito Stress Test kit (Agilent). 4×104 cells were seeded and grown for 24 h n DMEM containing 10 % FBS ...
-
bioRxiv - Cell Biology 2023Quote: All TTBK2 mutations were generated by PCR-based site-directed mutagenesis by using QuickChange Lighting Site-Directed-Mutagenesis kit (Agilent) using as a template pENTR/D-TOPO (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 μM of carbonylcyanide-4-(trifluoromethoxy)-phenylhydrazone (FCCP) (Seahorse XF Cell Energy Phenotype Test Kit from Agilent or Sigma Aldrich), and 1 μM of antimycin A and rotenone (Sigma Aldrich) ...
-
bioRxiv - Cell Biology 2023Quote: ... the HA epitope sequence was inserted immediately 3’ to the signal peptide sequence by site directed mutagenesis using the QuickchangeXL site directed Mutagenesis kit (Agilent) to obtain the following intermediate vector ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA libraries were finally assessed for quality with the Agilent 2100 BioAnalyzer using DNA high sensitivity kit (Agilent: 5067-4626) and quantified using Qubit DNA high sensitivity assay (Thermo Fischer Scientific ...
-
bioRxiv - Immunology 2023Quote: ... RNAseq analysis was performed by LC Sciences (Houston, TX) for RNA purity/quantity assessment via Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit (Agilent), mRNA extraction ...
-
bioRxiv - Genetics 2023Quote: ... The final libraries were quality checked and quantified for multiplexing using the Bioanalyzer High-Sensitivity DNA kit (Agilent, 5067-4626), Qubit dsDNA HS Assay kit (Thermo Scientific ...
-
bioRxiv - Genomics 2023Quote: ... The RNA quality was validated using NanoDrop and Agilent DNF-472 HS RNA (15 nt) Kit (Agilent Technologies, CA, USA) on the 5200 Agilent system to confirm the purity ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... An A to C mutation was made at base pair 219 within the CAT-I gene using the QuickChange Lightning Site-Directed Mutagenesis kit (Agilent) to match the native E ...
-
bioRxiv - Biophysics 2023Quote: ... A clone encoding tagless wild type PUS1 was then generated from PUS1D134A by converting alanine 134 back to wild type aspartate 134 using a QuickChange II XL kit and protocol (Agilent).
-
bioRxiv - Cell Biology 2023Quote: ... The total RNA yield was measured with a Nanodrop and the RNA integrity values (RIN) were obtained with a Bioanalyzer 2100 (Pico RNA 6000 Kit, Agilent). The values obtained for each of the samples are shown in Supplementary Table S1.
-
bioRxiv - Immunology 2023Quote: ... following the manufacturer’s instructions and were run on an Agilent 2100 Bioanalyzer using an Agilent High Sensitivity DNA kit (Agilent Technologies) to ensure the proper range of cDNA length distribution ...
-
bioRxiv - Plant Biology 2023Quote: ... and 2 µg DNase-treated RNA was reverse transcribed using a cDNA Synthesis Kit (Agilent Technologies, Santa Clara, CA, USA), following the respective manufacturer’s protocol ...
-
bioRxiv - Genetics 2023Quote: ... Point mutations in KCNJ1 were introduced into the resulting pRS415TEF1-ROMK1 vector using either two-step overlap extension mutagenesis (141) or site-directed mutagenesis with the QuikChange kit (Agilent Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... Point mutants of the vectors were constructed by site-directed mutagenesis using a QuikChange Site-Directed Mutagenesis kit (Stratagene, CA) (Yoshida et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... according to manufacturer’s instructions and the quality was assessed with the Agilent 2100 Bioanalyzer with an RNA 6000 Pico Kit (Agilent Technologies). PolyA-enriched RNA libraries were prepared with the KAPA Stranded mRNA Sample Preparation Kit (Kapa Biosystems).
-
bioRxiv - Cancer Biology 2023Quote: ... The mutagenic primers were designed using QuickChange primer design program at www.agilent.com/genomics/qcpd according to the guidelines mentioned in the manufacturer’s protocol (QuickChange Lightning Site-Directed Mutagenesis kit, Cat# 210518, Agilent Technologies). This was followed by mutant strand synthesis and transformation was performed as mentioned in the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... and finally 0.5 μM rotenone/antimycin A + 1 μg/μL Hoechst (Seahorse XF Cell Mito Stress Test Kit, Agilent, 103015) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... and finally 50 μM 2-deoxy-glucose (2-DG) + 1μg/μL Hoechst (Seahorse XF Glycolysis Stress Test Kit, Agilent, 103020) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... DNA integrity was evaluated with a Fragment Analyzer (Advanced Analytical Technologies) using the HS NGS Fragment Kit (DNF-467, Agilent). dsDNA HS assay (Thermo Fisher Scientific ...