Labshake search
Citations for Thermo Fisher :
4801 - 4850 of 10000+ citations for 2 3 5 6 Tetrahydroxy 4 phosphonooxycyclohexyl dihydrogen phosphate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... G cap on its 5’ terminal and poly (A) tail on its 3’ terminal using the mMESSAGE mMACHINE T7 Ultra Kit (Life Technologies). Both the Cas9 mRNA and the sgRNAs were purified using the MEGAclear Kit (Life Technologies ...
-
bioRxiv - Biochemistry 2024Quote: ... The grids were blotted with a blot force of 5 for 3 s before plunging into liquid ethan using a Vitrobot Mark IV (Thermo Fisher).
-
bioRxiv - Microbiology 2024Quote: ... Cells were infected at an MOI of 3 in a media solution with 5 μg/mL propidium iodide (Thermo Fisher P3566). Images of each well were acquired every 30 minutes until 14 h post-infection in two different systems due to the lab relocation in a different institute ...
-
bioRxiv - Neuroscience 2024Quote: Mouse bone marrow-derived macrophages (BMDMs) were collected from the femur and tibia from 3- to 5-month-old mice and grown in DMEM (Gibco, USA) supplemented with 10% fetal bovine serum (Gibco ...
-
bioRxiv - Bioengineering 2024Quote: ... and incubated for 3-5 minutes at 37°C with a 1:10 dilution of trypsin 2.5% (Thermo Fisher #15090-046) in PBS (HSCs ...
-
bioRxiv - Cancer Biology 2024Quote: ... slides were washed with PBS (3 times x 5 minutes) and mounted using Fluoromount-G (Thermo Fisher Scientific, #00-4958-02).
-
bioRxiv - Cell Biology 2024Quote: ... mouse calvariae were dissected from 1–3 days old neonatal mice and digested sequentially 5 times for 25 minutes in α-MEM (Gibco) containing 0.1% collagenase (Roche ...
-
bioRxiv - Physiology 2024Quote: ... the slides were rinsed again 3×5 min in PBS and mounted with SlowFade Diamond Antifade Mountant (ThermoFisher Scientific, Waltham, MA) with DAPI as a nuclear stain (Vector Laboratories ...
-
bioRxiv - Neuroscience 2024Quote: ... slices were washed 3 times in PBS for 5 minutes before secondary antibody solution (species-appropriate, Life Technologies Alexa Fluor-conjugated) 1:1000 in PBS/Triton/azide for 3 hours at room temperature ...
-
bioRxiv - Neuroscience 2024Quote: ... Sections were then washed again (3 x 5 min) in PBST and mounted under coverslips using Fluoromount-G™ with DAPI (Invitrogen). Slides were kept in the dark until imaging.
-
bioRxiv - Neuroscience 2024Quote: ... the concentration of nuclei was quantified by using two 5 μl aliquots with 5 μl resuspension buffer with 10 ug/mL DAPI on the Countess 3 Automated Cell Counter (Invitrogen, USA) to aim for a concentration between 700-1200 nuclei/μl ...
-
bioRxiv - Biophysics 2024Quote: ... against PIEZO1 that targets the 5’-AGCATTGAAGCGTAACAGGG-PAM-3’ at Chr.8: 122513787 - 122513809 on GRCm38 was purchased from Invitrogen (A35533). The cells were transfected with the Cas9 enzyme (TrueCut Cas9 Protein v2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... KHDRBS3 knockdown was performed by transfection of 50 nM of non-targeting siRNA (si-CTL) or specific siRNA targeting KHDRBS3 (si-KHDRBS3: 5′ GCGAAGUACUUCCAUCUCAAUGA-3’) (Dharmacon) with Lipofectamine RNAiMAX Transfection Reagent (Invitrogen, #13778075) following manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... The grids were blotted with a blot force of 5 for 3 s before plunging into liquid ethan using a Vitrobot Mark IV (Thermo Fisher). Grids were clipped and stored in liquid nitrogen until cryo-EM analysis.
-
bioRxiv - Biochemistry 2024Quote: ... Hypercarb column (100 × 2.1 mm, 3 µm) connected to a Hypercarb guard column (10 × 2.1 mm, 5 µm; Thermo Scientific, Waltham, USA) was used for analysis ...
-
bioRxiv - Bioengineering 2024Quote: HDFs derived from the 75-year-old donor were transfected with AMPKα2 siRNA oligonucleotides (5’ ACCGAGCUAUGAAGCAGCUGGAUUU 3’) (Invitrogen, Waltham, MA, USA). Lipofectamine RNAiMAX (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... membrane was washed 3 x 5 min in PBS-T and incubated for 1 hour at RT with secondary antibody anti-mouse (Invitrogen #31439) or anti-rabbit (Invitrogen #31460 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Slides were then rinsed 3×5 mins with washing buffer and nuclei were stained with NucBlue Fixed Cell Stain Ready Probe Reagent (Invitrogen #R37606) was prepared following the manufacturer’s instructions and cells were incubated for 15 mins at RT ...
-
bioRxiv - Cell Biology 2024Quote: ... resuspended in cold FACS buffer (PBS 3% FBS, 25 mM HEPES, 5 mM EDTA) and analysed on an Attune NxT flow cytometer (ThermoFisher Scientific), collecting at least 10,000 single cell events ...
-
ISL2 is an epigenetically silenced tumor suppressor and regulator of metabolism in pancreatic cancerbioRxiv - Molecular Biology 2020Quote: ... cells were stained by BODIPY™ FL C12 (4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Thermo Fisher Scientific #D3922) to determine the amount of lipid droplet in regular conditions ...
-
bioRxiv - Microbiology 2020Quote: ... 1.5×107 cells were incubated for 4 hours with 3 μL of AHA diluted in DMSO (Acros Organics via ThermoFisher Scientific, Germany) to final concentrations of 0 ...
-
bioRxiv - Microbiology 2020Quote: ... 1.5×107 cells were incubated for 4 hours with 3 μL of AHA diluted in DMSO (Acros Organics via ThermoFisher Scientific, Germany) to final concentrations of 0 ...
-
bioRxiv - Immunology 2021Quote: ... Cells were then placed again into the Cytofunnel and spun at 800 RPM for 3 min using a Cytospin™ 4 Cytocentrifuge (Thermo Fisher). For intracellular visualization of IgM ...
-
bioRxiv - Neuroscience 2020Quote: ... Brains were incubated with secondary antibody for 3 nights at 4°C with secondary antibodies at 1:500: goat anti-rabbit Alexa Fluor 488 (ThermoFisher #A-11008) and goat anti-mouse Alexa Fluor 647 (ThermoFisher #A-21236) ...
-
bioRxiv - Cell Biology 2021Quote: ... the catalysis of γ-glutamyl-3-carboxy-4-nitroanilide was measured at light absorbance at 410 nm using spectrophotometer (Thermo Fisher Scientific).
-
bioRxiv - Neuroscience 2020Quote: ... and probed overnight at 4°C with the following primary antibodies diluted in 1x TBS-T with 3% BSA (Fisher Scientific, BP1600): α-CD11b (1:1000 ...
-
bioRxiv - Microbiology 2020Quote: ... cells were washed 3 times in warm PBS and fixed for 45 min at room temperature in 4% (w/v) formaldehyde (Thermo Scientific; 28908) in PBS containing 0.1% Triton-X100 ...
-
bioRxiv - Cell Biology 2021Quote: ... The tissue was washed in warm PBS and incubated in pre-warmed Buffer 1 (PBS 93%, 0.5M EDTA 3%, RNA secure 4%, Thermo Fisher Scientific, Australia), at 37°C on a shaker for 10 minutes ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were passaged as aggregates every 3-4 days until they reach 60-70% confluency with 0.5mM EDTA diluted in PBS (Thermofisher, Canada. Catalog#15575020).
-
bioRxiv - Cancer Biology 2022Quote: ... culture medium was replaced with 100 µL full melanoma medium with 4 µM Caspase-3/7 activity dye (CellEvent, Thermo Fisher Scientific). Plates were then imaged on a Celigo Imaging Cytometer (Nexcelom ...
-
bioRxiv - Microbiology 2020Quote: ... The grids were blotted for 3-4 s and plunged into an ethane/propane mixture using a vitrification apparatus (Vitrobot, Thermo Fisher Scientific). For Fab 4G2-treated VLP EM sample preparation ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were washed with ice-cold PBS-BSA before secondary labeling for 1 h at 4°C in 3 mL1:200 PE-conjugated streptavidin (Thermo Fisher S866) to label for bound ACE2 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mice were immunized by injection of OVA coupled to the hapten 4-hydroxy-3-nitrophenylacetyl (NP-OVA) precipitated in alum (Imject® Alum, Thermo Scientific) into the hind footpads (25ul) ...
-
bioRxiv - Cell Biology 2020Quote: ... Equal masses of lysates were separated by SDS-PAGE using either 4-12% Bis Tris gels or 3-8% Tris acetate gels (Thermo Fisher Scientific). All IRS2 immunoblots were separated on 3-8% Tris acetate gels with the exception of those shown in Figures 5A and S4B ...
-
bioRxiv - Microbiology 2020Quote: ... Pre-cleared lysates were further incubated at 4°C overnight with the indicated antibodies (1 to 3 μl) and protein A agarose or protein G Dynabeads (Thermo Fisher Scientific). Immunoprecipitates were washed three times with RIPA buffer (LSB ...
-
bioRxiv - Genetics 2020Quote: ... 4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene 3-dodecanoic acid (BODIPY™ FL C12; Thermo Fisher Scientific, USA) (4 µg/mL ...
-
bioRxiv - Biochemistry 2022Quote: ... followed by mechanical blotting for 3-4 s and rapid vitrification in liquid ethane with a Vitrobot Mark IV plunge-freezing device (Thermo Fisher Scientific) operated at 4 °C and 100 % relative humidity.
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were then centrifuged at 1000rpm for 3 minutes at 4°C before being suspended in 100μl HBSS (ThermoFisher, Cat No. 14025) + 1% FBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... P8 pups were fed 1 μl 4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Hexadecanoic Acid BODIPY™ FL C16 (BODIPY FL C16, ThermoFisher Scientific, D3821) diluted in olive oil at a concentration of 10 μg/μL ...
-
bioRxiv - Neuroscience 2023Quote: ... Fibroblasts started to migrate out of the skin biopsies after 7-10 days and were transferred to two T75 flasks after 3-4 weeks using the standard splitting protocol with TrypLE™ Express enzyme (Thermo Fisher). Fibroblasts were then cultured in IMDM (Thermo Fisher) ...
-
bioRxiv - Neuroscience 2023Quote: ... 3 µL of 1 mM Fluo-4 AM (stock solution in DMSO) and 30 µL of PowerLoad Concentrate (100X, Thermo Fisher Scientific) were vortexed vigorously ...
-
bioRxiv - Physiology 2023Quote: ... 100 ng pMD2 and 400 ng of each sgRNA CRISPR Cas9 lentivirus plasmid (plasmid amount rate 3:1:4) using Turbofect transfection reagent (Thermo Fisher Scientific). Lentiviral media was centrifuged once at 1500 x g for 3 minutes and the supernatant was collected ...
-
bioRxiv - Neuroscience 2022Quote: ... and cells were passaged every 3-4 days once reaching 70-80% confluency using pre-warmed Versene (Fisher Scientific #15-040-066).
-
bioRxiv - Developmental Biology 2022Quote: ... Epithelial sheets of embryos from the same litter were pooled (3-4 embryos per sample) and incubated for 10 min at RT in TrypLE Select Enzyme (Life Technologies/Gibco). Dissociated cells were resuspended in 0.5% BSA ...
-
bioRxiv - Cell Biology 2022Quote: HTM cells cultured atop ECM hydrogels in presence of the different treatments for 3 days were fixed with 4% paraformaldehyde (Thermo Fisher Scientific) at room temperature for 20 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... We used siDESIGN Center (Horizon Discovery) to design siRNA (siUNG#4) targeting the 3′UTR region of UNG mRNA (Thermo Fisher Scientific).
-
bioRxiv - Biochemistry 2024Quote: HEK-293 cells (ATCC, CRL-1573) were subcultured every 3-4 days in Dulbecco’s modified Eagle’s medium (Thermo Fisher Scientific, 41965-039) supplemented with 10% v/v fetal bovine serum (Sigma Aldrich ...
-
bioRxiv - Biophysics 2023Quote: ... with a FuGene: DNA ratio of 3:1 using 4 μg of DNA in OptiMEM Reduced Serum Medium (ThermoFisher Scientific Catalog #11058021). The transfection medium was removed from cells ∼6–8 h post transfection ...
-
bioRxiv - Neuroscience 2023Quote: ... before being spun (5000rpm 4⁰C for 3 minutes) and homogenised (70 seconds with a pestle) in 300 ul trizol (Invitrogen 15596-026). RNA was extracted using the Zymo Direct-zol RNA Microprep Kit (Zymo Research ...
-
bioRxiv - Genetics 2023Quote: ... Total RNA was extracted from n = 3–4 biological replicates per sample using the PureLink RNA Mini Kit (Invitrogen, Waltham, MA, USA), and sample quality was evaluated using a TapeStation ...