Labshake search
Citations for Thermo Fisher :
4751 - 4800 of 10000+ citations for 2 3 5 6 Tetrahydroxy 4 phosphonooxycyclohexyl dihydrogen phosphate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... cells were transfected with 1µM of either control or CARP2 specific siRNA- sequence is − 5’ UGACAUCUCUACCGAAAUG 3’ using RNAimax (13778-075, Thermo Fisher Scientific) as per manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: ... Blots were then washed three times for 5 min in PBS-T.3 and developed with ECL reagents per manufacturer instructions (SuperSignal West Pico Chemiluminescent Substrate; Thermo Fisher). FW blots were visualized with a LAS-3000 digital imaging system (Fujifilm ...
-
bioRxiv - Developmental Biology 2021Quote: ... Slices were then washed in PBS (3 × 10 min) followed by a 5 min incubation with DAPI (Thermofisher Scientific, 1: 5000) diluted in PBS ...
-
bioRxiv - Molecular Biology 2021Quote: A biotin-labeled circPTPN12 probe and an unlabeled probe (5’-AGGCCATTACAATGATCTGCAATGAATAC-3’, General Biosystems, Chuzhou, China) were separately incubated with streptavidin-coated magnetic beads (Thermo Scientific), followed by incubation with the lysates of HEK-293T cells transfected with circPTPN12 plasmid ...
-
bioRxiv - Immunology 2020Quote: ... 3.125 μM Oligo-dT 30 VN (IDT, 5’AAGCAGTGGTATCAACGCAGAGTACT 30 VN-3’) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740) into 384-well hard-shell PCR plates (Biorad HSP3901 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Both sections and co-cultures were blocked with 3% Bovine Serum Albumin (BSA, Fisher Bioreagents) and 5% normal goat serum (NGS, Gibco PCN5000) in PBS for 1 hour at room temperature ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3.125 μM Oligo-dT 30 VN (IDT, 5′AAGCAGTGGTATCAACGCAGAGTACT 30 VN-3′) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740)) into 384-well hard-shell PCR plates (Biorad HSP3901 ...
-
bioRxiv - Developmental Biology 2022Quote: ... with cDNA (diluted 1:5) and gene-specific primers (Key Resources Table) on a QuantStudio 3 Real-Time PCR System (Applied Biosystems) in triplicate ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNAs were quantified by qPCR using the prima-QUANT CYBR Master Mix (Steinbrenner Laborsysteme) in a QuantStudio 5 or 3 Real-Time PCR System (Applied Biosystems). The primers used are listed in Suppl ...
-
bioRxiv - Neuroscience 2020Quote: ... cells were washed 3 times in PBS for 5 minutes before being incubated with AlexaFluor 488 or AlexaFluor 568 (Thermo Fisher) rabbit or mouse secondary antibodies for 1 hour at room temperature ...
-
bioRxiv - Immunology 2021Quote: ... Blots were washed in TBST (3 x 5 min) and developed using SuperSignal™ West Dura Extended Duration Substrate (ThermoFisher Scientific) and an ImageQuant Gel imager (GE Healthcare).
-
bioRxiv - Cell Biology 2020Quote: A TrueGuide crRNA directed against exon 1 of Hs IRS2’s coding region (target DNA sequence: 5’-TCG AGA GCG ATC ACC CGT TT −3’, Assay ID number: CRISPR850215_CR, Thermo Fisher Scientific) was annealed to the TrueGuide tracrRNA (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... were cultured in DMEM-F12 containing PS and 5% FBS for CHO cells or 3% FBS for CHO-ldlD cells and transfected using Lipofectamine 2000 (Thermo Fisher) following standard protocol ...
-
bioRxiv - Evolutionary Biology 2021Quote: For ethanol preference assays, experimental substrates were 1% agarose and contained 75mM sucrose and increasing concentrations (3%, 5%, and 7%) of ethanol (ThermoFisher #BP2818); control substrates were 1% agarose and contained 75mM sucrose.
-
bioRxiv - Cell Biology 2021Quote: ... Slides were then washed 3 x 5 minutes with PBS and incubated with the Anti-guinea pig IgG Alexa Fluor 488 (1:200, Life Technologies) diluted in 10% FBS for 1 hour at room temperature ...
-
bioRxiv - Biochemistry 2021Quote: ... The extracted lipids (5 μL/injection) were separated on an Acclaim PepMap 100 C18 column (3 μm, 1.0 × 150 mm, Thermo Fisher Scientific) at a flow rate of 0.045 mL/min with a linear gradient of solvent A and solvent B ...
-
bioRxiv - Neuroscience 2021Quote: ... 1.0 μM reverse internal control primer [5’-CTTGTTGAGAACAAACTCCTGCAGCT-3’] and Dream Taq Hot Start Green PCR Master Mix (Thermo Fisher Scientific). Cycling conditions were 3 min at 95°C ...
-
bioRxiv - Immunology 2021Quote: ... RRV cDNA was generated from 10 μl of serum derived RNA or 1 μg of tissue derived RNA using a sequence-tagged (indicated with lower case letters) RRV-specific RT primer (5′-ggcagtatcgtgaattcgatgcAACACTCCCGTCGACAACAGA-3′) with SuperScript IV reverse tran-scriptase (Life Technologies). RRV genomes were quantified by RT-qPCR using a tag sequence-specific reverse primer (5′-GGCAGTATCGTGAATTCGATGC-3′ ...
-
bioRxiv - Cell Biology 2021Quote: ... (Cai et al., 2009), or Kif15 (5’-GGACAUAAAUUGCAAAUAC-3’, 24 h) (Vanneste et al., 2009) using Lipofectamine RNAiMAX (13778075, Thermo Fisher) according to the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2020Quote: ... and 5’-GCTCCAGAGCAGAATGAGCTA-3’ (Reverse).ChIP samples were analyzed by real-time qPCR with the SYBR-Green Master Mix system (Life Technologies).
-
bioRxiv - Immunology 2021Quote: ... hemolymph was perfused from non-blood fed mosquitoes (3 to 5 days old) and placed on a superfrost microscopic slide (Fisher Scientific) to adhere at RT for 20 min ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was generated from plasma RNA using the primer YB383 5’-TTTTTTTTTTTTTTTTTTTTTTTTRAAGCAC-3’ as per the manufacturer’s protocol for the Superscript III Reverse Transcriptase (Thermo Fisher Scientific). cDNA was additionally treated with Ribonuclease H (Thermo Fisher ...
-
bioRxiv - Immunology 2020Quote: ... and 5’-AATGGGAAGTCACGAAGGTG-3’(reverse) and quantitative real-time RT–PCR was conducted on a StepOne Plus PCR instrument (Applied Biosystems). The NF-κB-luciferase (Luc2p ...
-
bioRxiv - Genomics 2020Quote: ... 5′-CAGACTCAACCTCCTCAGG-3′-R) in a total volume of 20 µl of Luminaris HiGreen High ROX qPCR Master Mix (Thermo Scientific) in a real-time thermal cycler STEPOnePlus (A&B Applied Biosystems ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue sections and cultured cells were blocked with 3% bovine serum albumin (BSA, Fisher Bioreagents) and 5% normal goat serum (NGS, Gibco #PCN5000) in PBS for 1 hour at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... Eluted vRNA was subsequently used as a template for cDNA synthesis and reverse-transcribed using the reverse primer SHIV.Env.R1 (5’-TACCCCTACCAAGTCATCA-3’) and SuperScript III reverse transcriptase (Thermo Fisher Scientific #18080044). cDNA was serially diluted to identify the dilution at which <30% of wells contained PCR amplicons of the correct size ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10μg of total protein were heat-denatured for 5 minutes at 100°C before loading onto NuPAGE 3– 8% TRIS Acetate Midi Gel (Novex, Life Technologies) and transferred to PVDF membranes (Millipore) ...
-
bioRxiv - Genetics 2023Quote: ... Ovaries were washed 3 times for 5 min with PBTx before incubation at room temperature in 1 μg/mL DAPI (Invitrogen, ThermoFisher Scientific) solution in PBS for 30 minutes ...
-
bioRxiv - Bioengineering 2023Quote: Tubular scaffolds were sterilized in a laminar flow cabinet by washing 3 times for 15 minutes in 5% penicillin/streptomycin (v/v, Gibco, Thermofisher Scientific) in phosphate buffered saline (PBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... at 30°C to an optical density at 600 nm of 3–5 and were harvested by centrifugation at 4000 rpm (Sorvall GS3 or SLA-3000, Thermo Scientific) for 8 min ...
-
bioRxiv - Biochemistry 2023Quote: ... Total RNA was extracted from individual tissues or pools of 3–5 midguts using TRIzol reagent (Invitrogen, Carlsbad, CA, United States) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... and sequenced with the M13 forward primer (5’-GTAAAACGACGGCCAG-3’) using a BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific).
-
bioRxiv - Cell Biology 2022Quote: ... The cells were then washed 3×5 min with PBS and mounted between a microscope slide and a coverslip using ProLong™ Gold Antifade Mountant (Invitrogen). The samples were cured at RT overnight and then stored at 4°C until imaged ...
-
bioRxiv - Neuroscience 2023Quote: ... Heads were washed with PAT for 5 hours and then incubated for 3 days in PAT-NGS with goat anti-rabbit AlexaFluor-488 (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... cells were washed and fed with the complete Lifeline medium plus antibiotics and transfected with 50 nM custom mirVana miRNA inhibitor (inhibitor sequence: 5′-GAGCCCGACGAGCUACCAGACUGCUCCA-3′, #4464086, ThermoFisher Scientific) or 50 nM mirVanna inhibitor negative control#1 (#4464077 ...
-
bioRxiv - Neuroscience 2024Quote: ... 3-5 mm skin biopsies were collected in Biopsy Collection Medium (RPMI 1460 [Thermo Fisher] with 1X Antibiotic-Antimycotic [Thermo Fisher]), cut into smaller pieces (<1 mm ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GGAGCCATGGCCGCGTCCGG-3’ and 5’-GGACGGGCGGTCGGTCTGAG-3’ were chosen as Cas9 targeted guide RNAs (sgRNAs) and in vitro transcribed using the MEGAshortscript Kit (ThermoFisher, USA) and subsequently purified using MEGAclearTM Kit ...
-
bioRxiv - Cancer Biology 2023Quote: ... KIF18A siRNAs used were a 1:1 mixture of two the following Silencer or Silencer Select Validated siRNAs (5’ to 3’ sequence): GCUGGAUUUCAUAAAGUGGtt (Ambion, AM51334), GCUUGUUCCAGAAUCGAGAtt (Ambion ...
-
bioRxiv - Biophysics 2024Quote: ... Texas Red-DHPE (Texas Red 1,2-dihexadecanoyl-sn-glycero-3-phosphoethanolamine triethylammonium salt), NeutrAvidin, and Zeba spin desalting columns (7K MWCO, 5 mL) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Systems Biology 2023Quote: ... Cells were washed 3 times for 5 min with PBS and incubated with Image-iT FX Signal Enhancer (Thermo Fisher Scientific) for 30 min at RT ...
-
bioRxiv - Neuroscience 2023Quote: ... The purified RNAs were reverse transcribed using the DP3 primer (5’- CCTTGGCACCCGAGAATTCCA-3’, 0.5 μM) and Superscript III reverse transcriptase (Invitrogen, 18080-044) and treated with Exonuclease I (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: ... slides or coverslips were washed 3 times for 5 min in PBS and incubated with appropriate species-specific Alexa Fluor-conjugated secondary antibodies (Molecular Probes). DNA was counterstained with Hoechst 33342 (Invitrogen) ...
-
bioRxiv - Cell Biology 2022Quote: ... inv474 (PDB: 1CWV) (in 5 3 direction) and flanked by SacI and HindIII restriction sites was synthetized and subcloned by Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fractions with the greatest quantity and purity of UBC9 protein combined and concentrated down to 5 ml using 3-kDa MWCO centrifugal concentrator (Thermo Scientific) at 4,000xg/4 °C ...
-
bioRxiv - Microbiology 2022Quote: ... These RNAs were 35 nucleotides long and they were prepared by in vitro transcription using a DNA template (5’-CAGTAATACGACTCACTATAGGGGAAGCGGGCATGCGGCCAGCCATAGCCGATCA-3’) and the TranscriptAid T7 high-yield transcription kit (Thermo Scientific). The reaction was performed in a 50-μl mixture containing 1× TranscriptAid reaction buffer ...
-
bioRxiv - Cancer Biology 2023Quote: ... Both the nuclear and chromatin pellet fractions were sonicated 3 times (5 seconds on, 20 seconds off; 30% amplitude; Sonic Dismembranator Model 500 (Fisher Scientific)) on ice ...
-
bioRxiv - Immunology 2023Quote: ... followed by first strand cDNA synthesis using either a NSP4 gene-specific forward primer with a random nucleotide tag sequence (5’-cggtcatggtggcgaataaGCGGCCTTTAATGTGGAATG-3) or without any primer according to the SuperScriptTM III Reverse Transcriptase protocol (Invitrogen, 18080044). cDNA synthesis was then completed followed by a PCR using an eGFP gene-specific reverse primer (5’-CACCTTGATGCCGTTCTTCT-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’-GAGACCCUAUCCGUGAUUAtt-3’ and antisense: 5’- UAAUCACGGAUAGGGUCUCtt-3’ (Silencer Select, rat negative control #1; scrambled siRNA and all siRNAs were from Ambion, Life Technologies). Transfection complexes were prepared in accordance with the instructions provided by the manufacturer and added to 2×105 cells seeded per well in 24-well plates.
-
bioRxiv - Cell Biology 2023Quote: ... KIF18A siRNA used was a 1:1 mixture of the following two Silencer Select Validated siRNAs (5’ to 3’ sequence): GCUGGAUUUCAUAAAGUGGtt (Ambion, AM51334) CGUUAACUGCAGACGUAAAtt (Ambion ...
-
bioRxiv - Immunology 2024Quote: ... Slides were washed extensively (3 x 5 mins) in TBS-tween20 and incubated in appropriately labeled secondary antibodies (Invitrogen Carlsbad, CA) for 1 h at RT ...