Labshake search
Citations for Thermo Fisher :
401 - 450 of 8899 citations for Vertical Gel Casting Cassettes since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... the spectinomycin cassette from the pAT28 plasmid [23] was amplified using primers 2836/2837 and cloned into the pBlunt2 plasmid (Invitrogen), giving rise to pTC129 ...
-
bioRxiv - Microbiology 2023Quote: ... The kanamycin resistance cassette flanked with 0.8 kb sequences homologous to the adjacent perRA sequences was obtained by gene synthesis (GeneArt, Life Technologies), and subsequently cloned into a kanamycin-resistant E ...
-
bioRxiv - Molecular Biology 2023Quote: ... The supernatant was treated with the Slide-A-Lyzer™ Dialysis Cassette Kit (#66382, Thermo Fisher Scientific, Waltham, MA, USA), added to 400 µL of glutathione- sepharose beads (Cytiva) ...
-
bioRxiv - Cell Biology 2023Quote: ... and with 0.5 % fetal calf serum that had been dialyzed against phosphate-buffered saline (PBS) in dialysis cassettes (Thermo Scientific) having an 3500 molecular weight cut-off ...
-
bioRxiv - Synthetic Biology 2023Quote: ... (2011) [34] for the cassette assembly by polymerase chain reaction (PCR) using Platinum SuperFi Master Mix (Thermo Fisher Scientific, Lithuania) following the manufacturer’s instruction for high GC content-templates ...
-
bioRxiv - Bioengineering 2023Quote: ... 2 mL of concentrated Col I was injected to a 3 mL 3.5k MWCO Slide-a-Lyzer Dialysis Cassette (Thermo Fisher) and dialyzed overnight against 2 L of sterile filtered aqueous labeling buffer (0.25 M NaHCO3 ...
-
bioRxiv - Biophysics 2023Quote: ... oligonucleotides were dialyzed in ∼1.5 L ultrapure water for 24 h using Slide-A-Lyzer cassettes (2 kDa cutoff, Thermo Scientific), where the water was replaced every ∼6 hrs ...
-
bioRxiv - Immunology 2023Quote: ... Culture supernatants were then dialyzed overnight at 4 °C in HBS (150mM NaCl, 10mM HEPES, pH 8.0) using 10kDa MWCO Slide-A-Lyzer dialysis cassettes (Thermo Scientific). Supernatants were passed over a 10 ml StrepTrap HP column (Cytiva ...
-
bioRxiv - Bioengineering 2023Quote: ... The product was then dialyzed against water using a Slide-A-Lyzer G2 10 kDa MWCO dialysis cassette (Thermo Scientific) for 1 week with daily water changes (2 L) ...
-
bioRxiv - Microbiology 2024Quote: A pEXG2-AmpR plasmid was derived from pEXG2-attP-Gm75 by digesting with NheI and EcoRV and ligating with an ampicillin resistance cassette amplified from PCR4 Blunt TOPO (Invitrogen) that was also digested with NheI and EcoRV ...
-
bioRxiv - Molecular Biology 2024Quote: ... The amplified and purified gene fragments is were further proceeded for dsRNA synthesis expression cassette was created using the MEGA-script kit (Ambion), following manufacturer’s instructions.
-
bioRxiv - Biochemistry 2023Quote: ... The samples were buffer exchanged to 20 mM HEPES pH 7.0 with the corresponding salt present at 50 mM with overnight dialysis using Slide-A-Lyzer dialysis cassettes from ThermoFisher scientific ...
-
bioRxiv - Plant Biology 2023Quote: ... cells were transformed with a linearized plasmid encoding mito-Clover and a hygromycin-resistance cassette using the Max Efficiency Reagent (Invitrogen). Resistant clones to hygromycin were screened for Clover fluorescence using a M1000 Tecan plate reader (Excitation ...
-
bioRxiv - Biophysics 2024Quote: ... LNPs were dialyzed overnight against 600× sample volume nuclease-free PBS using Slide-A-Lyzer G2 dialysis cassettes (Thermo Scientific) with a molecular weight cutoff of 10 K ...
-
bioRxiv - Cell Biology 2024Quote: ... tubes were allowed to reach room temperature before the eye samples were placed into tissue cassettes (Fisher Scientific, Catalog # 15200403D). The cassettes were then placed in 100% ethanol for 20 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... Protein samples were heated at 95°C for 5 minutes before loading and separated onto SDS-PAGE cassette (Thermo Fisher Scientific Bolt™ 4-12% Bis-Tris Plus Gels ...
-
bioRxiv - Developmental Biology 2024Quote: ... The 3 plasmids were shuttled into the backbone containing the cmcl2:GFP selection cassette (81) using the LR recombination (Invitrogen “Gateway LR Clonase II Plus Enzyme Mix” #12538-120) ...
-
bioRxiv - Genomics 2019Quote: ... size selection of the libraries was performed using an E-gel Safe Imager and 2% E-gel size select gels (Invitrogen). Indexed libraries were pooled and 100 bp paired-end sequenced on the same flow cell of an Illumina HiSeq4000 instrument at the Berkeley sequencing facility ...
-
bioRxiv - Biochemistry 2022Quote: ... DNA was analyzed using an E-Gel Power SNAP system on a 2% E-Gel Ex gel (Thermo Fisher Scientific).
-
bioRxiv - Genetics 2022Quote: ... An equal volume of each PCR was then pooled and 100 µL were used for gel extraction from a 4% E-Gel EX Agarose Gel (Invitrogen). The fragment size and quality of the extracted DNA were tested using a 2100 Bioanalyzer system (Agilent) ...
-
bioRxiv - Genomics 2019Quote: ... the amplicon was excised out of the gel and gel purified using the PureLink Quick Gel Extraction and PCR Purification Combo Kit (Invitrogen). The amplicons were sequenced as described above ...
-
bioRxiv - Genomics 2020Quote: ... DNA bands with the correct amplicon sizes were extracted via gel extraction and purification using 2% agarose precast gels (E-Gel EX, Invitrogen) and gel imager (E-Gel Safe Imager connected to E-Gel iBase ...
-
bioRxiv - Biophysics 2023Quote: ... and the 187 bp amplicon was gel purified using a 2% E-Gel™ EX Agarose Gels (ThermoFisher Scientific G401002) and QIAquick Gel Extraction Kit (Qiagen 28704) ...
-
bioRxiv - Microbiology 2023Quote: ... and the resulting 514 bp fragment was gel purified from a 1.5% Agarose gel using the GeneJet Gel Extraction Kit (Thermo Scientific). The plasmid pLenti-DsRed_IRES_EGFP (Addgene plasmid # 92194 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The PCR product from each well was then run on an agarose gel (E-Gel EX Agarose Gels 2%, Invitrogen) with a 50 bp ladder (Invitrogen) ...
-
bioRxiv - Biochemistry 2023Quote: ... Protein material was separated via SDS– polyacrylamide gel electrophoresis (SDS-PAGE) (12, 15, or 17 well gels, 4-20% Bis-tris BOLT gels, Invitrogen), with 1X MOPS Buffer (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... Proteins were separated on precast Novex 10% Tris-Glycine gel / NuPAGE 4-12% Bis-Tris gel at 100V using the Mini Gel Tank (Invitrogen) and were blotted onto PVDF membrane at 20V for 90 min ...
-
bioRxiv - Biochemistry 2023Quote: ... and the 187 bp amplicon was gel purified using a 2% E-Gel™ EX Agarose Gels (ThermoFisher Scientific G401002) and QIAquick Gel Extraction Kit (Qiagen 28704) ...
-
bioRxiv - Biochemistry 2023Quote: ... Samples were boiled for 5 min and subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) on either 10% gels (cast freshly) or 4-20% gradient gels (Invitrogen). Proteins were transferred to polyvinylidene fluoride (PVDF ...
-
bioRxiv - Cell Biology 2020Quote: ... SDS-PAGE gel was incubated in Sypro Red protein gel stain (ThermoFisher) at 1:5000 in 7.5% acetic acid for 45 mins ...
-
bioRxiv - Immunology 2020Quote: ... and resolved by SDS gel electrophoresis on 10% Bis-Tris gels (Invitrogen). Resolved proteins were transferred to 0.45 μm Nitrocellulose membranes (Bio-Rad) ...
-
bioRxiv - Biochemistry 2020Quote: ... Gels were stained with ProQ Diamond Phosphoprotein Gel Stain (Thermo Fisher Scientific) according to the manufacturer’s instructions and imaged on a Typhoon Bioimager (GE Healthcare ...
-
bioRxiv - Immunology 2021Quote: ... for reducing gels and 4-12% Bis0Tris NativePAGE gels (Invitrogen, Cat #BN1002BOX) for native ...
-
bioRxiv - Biochemistry 2021Quote: ... The gel was stained with SYBR Gold nucleic acid gel stain (Invitrogen), bands visualized on a UV transilluminator ...
-
bioRxiv - Biochemistry 2020Quote: ... After transfer the gels were stained with Gel Code Blue (Thermofisher, #24952) for 1 hour and then destained with water for 1 hour ...
-
bioRxiv - Microbiology 2020Quote: ... The gels were subsequently stained with SYBR Safe DNA gel stain (Invitrogen) at 1/10,000 dilution in TBE buffer for 2 h with rocking and visualised using a Gel Doc EZ Imager (Bio-Rad) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Gel electrophoresis was performed using 4-12% Bis-Tris gels (ThermoFisher, NP0326BOX) and run in NuPAGE™ MOPS running buffer (ThermoFisher ...
-
bioRxiv - Systems Biology 2021Quote: ... Barcoded libraries were gel purified using PureLink Quick Gel Extraction kit (ThermoFisher) and sequenced on an Illumina HiSeq2500 using single-read sequencing and were completed with standard primers for dual indexing with HiSeq SBS Kit v4 reagents as described in (Aregger et al. ...
-
bioRxiv - Microbiology 2020Quote: ... gels or NuPage Tris-Acetate 3-8% gels (Invitrogen, Carlsbad, CA, USA). Proteins were transferred using iBlot dry transfer system (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... Gel extraction was done using PureLink Quick Gel Extraction kit (ThermoFisher Scientific). Gibson Assembly Master Mix was procured from New England Biolabs ...
-
bioRxiv - Neuroscience 2020Quote: ... the final superpool was gel-purified from 2% agarose gel (Invitrogen, 10135444) with the Zymoclean Gel DNA Recovery kit (Zymo Research ...
-
bioRxiv - Biochemistry 2021Quote: ... The gel was stained with SYBR Gold Nucleic Acid Gel stain (Invitrogen) and imaged with a ChemiDoc MP Imaging system (Bio-Rad Laboratories) ...
-
bioRxiv - Microbiology 2020Quote: ... duplicate gels were stained with SYPRO Ruby protein gel stain (ThermoFisher Scientific) and visualized with UV light.
-
bioRxiv - Physiology 2022Quote: ... The gels were dried using the DryEase mini Gel Drying systems (Invitrogen) according to the manufacture protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... Gels were stained with SYBR™ Gold Nucleic Acid Gel Stain (Invitrogen) and imaged on a ChemiDoc™ Touch Imaging System (BioRad) ...
-
bioRxiv - Cell Biology 2022Quote: ... Gel electrophoresis was performed on a 4-12% Bis-Tris gel (ThermoFisher) with 1X NuPage MOPS running buffer (ThermoFisher ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Gels were stained by SYBR™ Gold Nucleic Acid Gel Stain (Invitrogen), imaged by ChemDoc XRS+ (BioRad) ...
-
bioRxiv - Cell Biology 2023Quote: ... Agarose gel electrophoresis was done using gels made with TBE (Thermo Scientific), with DNA visualized under UV ...
-
bioRxiv - Immunology 2023Quote: ... Reverse: ACATCTAAGGGCATCACAGACC) and purified by gel extraction (Quick Gel Extraction kit, Invitrogen). qPCR was performed on a QuantStudio 7 flex and expression calculated using standard curves and results normalised to 18s expression ...
-
bioRxiv - Genetics 2023Quote: ... Samples were further purified by 2% E-Gel SizeSelect agarose gel (Invitrogen). The resulting products were purified using QIAquick PCR Purification Kit (Qiagen) ...