Labshake search
Citations for Thermo Fisher :
251 - 300 of 8899 citations for Vertical Gel Casting Cassettes since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... The cassettes were then submerged into a jar full of RNAlater (RNAlater™ Stabilization Solution, AM7021, Invitrogen) and stored at 4°C overnight ...
-
bioRxiv - Biophysics 2023Quote: ... and 0.02% NP40 substitute) in a 10 kDa cut off Slide-A-Lyzer Cassette (Thermo Scientific #66380), and concentrated in an Amicon Ultra-4 Ultracell 30kDa centrifugal filter (Merck-Millipore #UFC803024) ...
-
bioRxiv - Microbiology 2023Quote: ... dialyzed against Phage Buffer 2.0 in 20k MWCO Slide-A-Lyzer dialysis cassettes (cat#66003, Thermo Scientific), concentrated on Amicon ultra filters (cat#UFC810024 ...
-
bioRxiv - Immunology 2024Quote: ... Purified IgG antibodies were dialyzed against PBS using Slide-A-Lyzer Cassettes (10K MWCO; Thermo Fisher Scientific), and quantified using NanoDrop™ ONE instrument (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2024Quote: ... the protein was dialyzed in 0.5x PBS using a Slide-A-Lyzer Dialysis Cassette (Thermo Fisher Scientific).
-
bioRxiv - Microbiology 2024Quote: ... recombination cassettes were generated from the pEPKanS template with Phusion High Fidelity DNA polymerase (Thermo Fisher Scientific) by polymerase chain reaction (PCR ...
-
bioRxiv - Biophysics 2024Quote: ... 10kbp) as well as dialysis cassettes (Slide-A-Lyzer G2 3kda cutoff) were obtained from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Bioengineering 2023Quote: ... RNA integrity was confirmed by gel electrophoresis on E-gel EX 2% agarose gels (Thermofisher).
-
bioRxiv - Plant Biology 2021Quote: ... Fragments were gel-purified (GeneJET Gel Extraction Kit, ThermoFisher) and recombined into pDONRTM207 using Gateway® BP clonaseTM II enzyme mix (ThermoFisher) ...
-
bioRxiv - Neuroscience 2023Quote: ... gels supplemented with SYBR Safe DNA gel stain (Invitrogen).
-
bioRxiv - Synthetic Biology 2022Quote: ... gel purified (Thermo Scientific™ GeneJET Gel Purification Kit). All plasmid assemblies were conducted with Gibson Assembly66 and transformed into One Shot® TOP10 Escherichia coli (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2023Quote: ... using commercial gels (Invitrogen, E-Gel EX, 4% agarose). Product containing fractions of adequate purity were pooled ...
-
bioRxiv - Microbiology 2024Quote: ... the gels incubated in Gel-Dry Drying Solution (Invitrogen) for 10 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... Gels were either pre-cast 4-15% gels (Invitrogen) or a 4-20% gradient gel was prepared in glass cassettes 41.
-
bioRxiv - Neuroscience 2020Quote: ... low molecular weight gels Tris-Tricine gels or pre-casted gels 4-20% (Thermo Fisher Scientific), and transferred onto nitrocellulose membranes (GE Healthcare ...
-
bioRxiv - Cancer Biology 2023Quote: ... Gel electrophoresis was performed on 2.5% agarose gel with 10,000X SYBR Safe DNA gel stain (Invitrogen). 1 kb and 100 bp DNA Ladders (New England Biolabs ...
-
bioRxiv - Immunology 2021Quote: ... the sample was dialyzed using phosphate buffered saline and 10MWCO Slide-A-Lyzer dialysis cassettes (Thermo Fisher Scientific). SARS-CoV-2 spike protein (S ...
-
bioRxiv - Microbiology 2022Quote: ... and the fractions with the highest concentration were transferred in a Slide-A-Lyzer dialysis cassette (Thermo Fisher) and dialyzed to buffer (20 mM Tris-HCl pH 7.4 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Using primers PseudoRFPF ( CAACAAAATTATAGCAGAATGCAACGTCGACAAAAGGCTCAAGAAATTAACGGCCTACAC GCGGGTCCCATTGTTTGCCTCT) and PseudoPACR ( GTTTTGGCGCGTTGTTCCGTATCTGCTGAGCAAACCTTTTGCGCCGGCTGCTGCGGCGGATAACTATTTTCTTT GATGAAAG) we amplified the RFPscePAC cassette using Phusion Polymerase (ThermoFisher). 5 μg of PCR product was used for transfection using standard protocols ...
-
bioRxiv - Bioengineering 2019Quote: ... was created by ligating a 1.1 kb ZeoR expression cassette PCR amplified from plasmid pSV40/Zeo2 (ThermoFisher Scientific) using 5’ phosphorylated primer pair ZeoMluIFor/ZeoMluIRev ...
-
bioRxiv - Biophysics 2020Quote: ... Purified protein-lipid vesicles were reconstituted by dialysis (3500 Da cutoff Slide-A-Lyzer dialysis cassette, ThermoFisher Scientific) against excess 25mM phosphate buffer (pH 7.4 ...
-
bioRxiv - Plant Biology 2021Quote: ... and the binary vector pR4GWB501 to form the pAtCCA1ex4:intronLUC+ expression cassette using Gateway LR Clonase II (Invitrogen). The corresponding construct ...
-
bioRxiv - Microbiology 2021Quote: ... The formulation was then dialyzed using Slide-A-Lyzer® Dialysis cassette (WMCO 3.5 kDa, Thermo Fisher, #66330) against 1 X DPBS for 1 h ...
-
bioRxiv - Cancer Biology 2021Quote: Recombinant STUB1 protein (aa25-aa153) was dialyzed overnight with Slide-A-Lyzer cassette (7K MWCO, Thermo Scientific, #66373) in 1 liter of dialysis buffer (PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... Imidazole was removed from collected fractions by overnight dialysis using 10K MWCO cassette (Thermo Scientific, ref. no. 66807) in PBS ...
-
bioRxiv - Bioengineering 2022Quote: ... then the potentially formulated vaccine was dialyzed with a Slide-A-Lyzer Dialysis Cassette (Thermo Scientific, MWCO 3500) against PBS at 4°C under constant stirring for 4 h ...
-
bioRxiv - Immunology 2022Quote: ... Purified serum antibodies were dialyzed against PBS using Slide-A-Lyzer® Cassettes (10K MWCO, Thermo Fisher Scientific).
-
bioRxiv - Immunology 2020Quote: ... dialyzed with 3 changes of PBS pH 7.4 using Slide-A-Lyzer-G2 10K dialysis cassettes (Thermo Fisher), and concentrated using 30,000 kDa molecular weight cutoff polyethersulfone membrane spin columns (Pierce) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and then emerald GFP-miR cassette was PCR amplified and subcloned into the viral expression vector pRRLsinPPT (Invitrogen). Viral particles were produced in HEK-293T cells as previously described (Thomas et al. ...
-
bioRxiv - Biochemistry 2021Quote: ... The histone mixture was then injected into a Slide-A-Lyzer MINI dialysis cassette (3.5 kDa MWCO, ThermoFisher) and dialyzed at 4 °C into Octamer Refolding Buffer (10 mM Tris ...
-
bioRxiv - Bioengineering 2021Quote: ... Purified proteins were dialyzed against phosphate-buffered saline (PBS) using dialysis cassettes at 4°C (Thermo Fisher Scientific). Spike was dialyzed with a 20 kDa molecular weight cutoff (MWCO ...
-
bioRxiv - Immunology 2022Quote: ... The purified protein buffer was exchanged to PBS using a Slide-A-Lyzer™ Dialysis Cassette (Thermo Fisher).
-
bioRxiv - Biophysics 2022Quote: ... The sample was dialyzed overnight in a 3.5kDa molecular weight cutoff dialysis cassette (Slide-a-Lyzer, Thermo Fisher) at 4°C against 20 mM HEPES ...
-
bioRxiv - Microbiology 2023Quote: ... the CmPcL cassette and the synthetic adhesins construction were amplified by PCR (PCR master mix, Thermo Scientific, F548) using long floating primers that carry 40 bp of homology with the insertion region at each end ...
-
bioRxiv - Neuroscience 2023Quote: ... the expression cassettes were inserted in the pcDNA3 or pcDNA3.1+ (hygromycin) expression vectors (Thermo Fisher Scientific, MA, USA). For generation of stable cell lines ...
-
bioRxiv - Immunology 2023Quote: ... Any remaining CsCl was removed by dialysis using a Slide-a-Lyzer 10,000 MWCO dialysis cassette (Thermo Scientific) in SM buffer.
-
bioRxiv - Cell Biology 2023Quote: ... 50mM Hepes pH 7.4) using a slide-a-lyzer cassette and a 20,000MW cutoff (Thermo-Fisher Scientific 87735). Protein was labeled using an atto-488-NHS ester (Sigma Aldrich 41698 ...
-
bioRxiv - Microbiology 2023Quote: ... The harvested lipid-rich material went through 2h dialysis within 2K molecular-weight cut off cassettes (Thermo Scientific) to be reconstituted into phosphate-buffered saline (PBS) ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 mM DTT using 0.5 - 3 mL 3.5 MWCO Slide-A-Lyzer™ Dialysis Cassette (Thermo Fisher Scientific) at 4°C for 4 hours ...
-
bioRxiv - Plant Biology 2024Quote: ... The gRNA cassette from the pUC57 vector was sub-cloned into vector pOsCas9 by Gateway LR-Clonase (Invitrogen). The CRISPR/Cas9 vector was transformed into Agrobacterium tumefaciens strain AGL1 ...
-
bioRxiv - Microbiology 2024Quote: ... mAb pool was dialyzed in PBS pH 7.4 using Slide-A-Lyzer G2 Dialysis Cassette 3.5K (Thermo Scientific) overnight at 4°C ...
-
bioRxiv - Microbiology 2024Quote: The sgRNA cassettes were amplified through polymerase chain reaction (PCR) using DreamTaq® polymerase (5U/µL, ThermoFisher, EP0702). To achieve optimal library coverage ...
-
bioRxiv - Biochemistry 2024Quote: ... 0.5 mM tris(2-carboxyethyl)phosphine (TCEP) overnight using 3.5kDa MWCO Slide-A-Lyzer dialysis cassettes (ThermoFisher Scientific). The protein was combined with 5x molar excess of Alexa Fluor 488 NHS-ester dye (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... PCR amplicon was purified with E-Gel EX gel (Invitrogen) and QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Bioengineering 2020Quote: ... and 2% agarose gels (E-Gel, #G501802, Thermo Fisher Scientific).
-
bioRxiv - Microbiology 2020Quote: ... gel extracted using the GeneJET Gel Extraction kit (Thermo Scientific) and cloned into the p2CT plasmid (gift by James Berger ...
-
bioRxiv - Systems Biology 2021Quote: ... Lysates were analyzed with SDS – polyacrylamide gel electrophoresis gels (Invitrogen). Proteins were transferred onto polyvinylidene difluoride (PVDF ...
-
bioRxiv - Cell Biology 2022Quote: ... Gels were stained with SyproRuby protein gel stain (Life Technologies) according to the manufacturer’s instructions and imaged on a Typhoon FLA 9500 biomolecular imager (GE Healthcare) ...
-
bioRxiv - Biochemistry 2022Quote: ... The gel was stained with Gel-code Blue (Thermo Fisher) and the WNG1 bands were cut out into small pieces and transferred to fresh tubes ...
-
bioRxiv - Biophysics 2023Quote: ... and gel purified using an Invitrogen gel purification kit (Invitrogen) following the manufacturer’s protocol ...