Labshake search
Citations for Thermo Fisher :
4401 - 4450 of 10000+ citations for 1 6 Bismaleimidoethane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... HEK293 cells (wild-type or mS37 knock-out) were transfected in 6-well cell culture dish at 70% confluency with 2 μg plasmid using Lipofectamine 2000 (ThermoFisher scientific, Cat#11668027). Cells were collected after 72h ...
-
bioRxiv - Immunology 2022Quote: Primary T lymphocytes were isolated from lymph nodes of C57BL/6 mice using the Dynabeads™ Untouched™ mouse T cell kit (Invitrogen™) by negative selection ...
-
bioRxiv - Molecular Biology 2022Quote: ... All sections were mounted with 50μl of ProLong Gold Antifade mounting media containing a fluorescent nucleic acid dye 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific, P36931) before imaging ...
-
bioRxiv - Neuroscience 2024Quote: Separation of neurites and somata was achieved by differentiating and maintaining neurons on Nunc™ Polycarbonate Cell Culture Inserts for 6-well plates with a 3µm pore size (Thermo Fisher Scientific; 140642). Prior to cell plating ...
-
bioRxiv - Neuroscience 2024Quote: Collected rosettes were plated onto a polyhema-treated 6-cm Petri dish in NDMB medium containing NDM and 2% B27 w/o vitamin A (Gibco, Grand Island, NY), supplemented with 10ng/ml IGF-1 ...
-
bioRxiv - Immunology 2024Quote: ... CD4+ T cells were isolated from spleens and lymph nodes of donor C57BL/6 and IFNγ-/- mice using the MagniSort CD4+ T cell enrichment kit (ThermoFisher, #8804-6821-74). Flow cytometry confirmed that >85% of isolated live CD4+ T cells were naïve (CD44loCD62Lhi) ...
-
bioRxiv - Immunology 2024Quote: ... followed by 40 cycles of denaturation at 95 °C for 30 sec and extension at 60 °C for 30 sec in the QuantStudio 6 system (Applied Biosystems Co., USA). At the end of PCR ...
-
bioRxiv - Immunology 2024Quote: ... followed by 40 cycles of denaturation at 95 °C for 5 sec and extension at 58 °C for 34 sec in the QuantStudio 6 system (Applied Biosystems Co., USA). At the end of PCR ...
-
bioRxiv - Neuroscience 2023Quote: ... The spheroids were left intact for two days to form properly and at D1 the medium was exchanged with Essential 6 medium (Thermo Fisher Scientific, A1516401) supplemented with 10 μM Ri ...
-
bioRxiv - Bioengineering 2023Quote: ... SMLCs left at the bottom of 6-well plates after selective passaging were cultured in DMEM/F-12 medium (Thermo Fisher, cat# 11320074) supplemented with 10% FBS (Thermo Fisher ...
-
bioRxiv - Pathology 2023Quote: ... Assays were performed in quadruplicate in 20-µl reaction mixtures using the Applied Biosystems QuantStudio 6 Flex real-time PCR system (Thermo Fisher Scientific, USA). PCR was performed according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Total cDNA was obtained by reverse transcription using random hexamers pd(N)6 and M-MLV reverse transcriptase (Life Technologies, Carlsbad, CA, USA) at 42 °C for 50min ...
-
bioRxiv - Neuroscience 2023Quote: Paraffin-embedded frontal cortex tissue blocks from nondemented controls and patients with AD were cut at 6 µm using a microtome (HM340E, Thermo Fisher Scientific, USA). Coronal sections of the mouse brains were cut at 6 μm using a microtome ...
-
bioRxiv - Bioengineering 2023Quote: ... These slices were then fixed in 4’,6-diamidino-2-phenylindole (DAPI) mounting media (Fluoromount-G® with DAPI, Thermo Fisher Scientific, USA), and washed twice with PBS ...
-
bioRxiv - Molecular Biology 2023Quote: HEK293T cells (ATCC) were cultured in 6-well tissue culture plates (CytoOne, USA Scientific) using Dulbecco’s Modified Eagle Medium (Gibco, supplemented with 10% FBS) at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... SH-SY5Y were seeded onto 6-well plates (200.000 cells/well) and transfected using the Lipofectamine 2000 reagent (Thermo Fisher Scientific, Milan, Italy) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: ... Transfection lasted for 6 hours at 37°C and was terminated by replacing the medium with fresh 37°C Opti-MEM® (Life Technologies, ThermoFisher Scientific) supplemented with 50 μg/mL Gentamycin (Invitrogen) ...
-
bioRxiv - Cell Biology 2023Quote: ... 25,000-50,000 cells were plated and transfection of specified constructs or empty vector (6-13 µg/nL) was performed with Lipofectamine 2000 (Thermo Fisher Scientific, 1166819) and Opti-MEM (Gipco ...
-
bioRxiv - Neuroscience 2023Quote: ... Spheroids were lifted from each microwell by pipetting medium in the well up and down with a cut P1000 pipet tip and were placed in Essential 6 medium (Thermo Fisher Scientific, A1516401) with the SMAD pathway inhibitors dorsomorphin (2.5 μM ...
-
bioRxiv - Neuroscience 2023Quote: ... Slices were then stained with 4′,6-diamidino-2-phenylindole (DAPI) to stain cell nuclei and mounted with Immu-Mount mountant (Thermo Scientific, Cat# 9990402) onto microscope slides.
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Tandem Mass Tag 6-plex labelling of eluted RNA-binding proteins was performed using the TMTsixplex Isobaric Mass Tagging Kit (Thermo Scientific; Rockford, IL) and analysis by liquid chromatography tandem mass spectrometry (LC-MS/MS ...
-
bioRxiv - Cell Biology 2023Quote: ... using 1/10 of the volume of the culture medium and sonicated 6 x 10 sec (at 50% intensity, using a Fisher Scientific FB120 sonicator). Lysates were spun at 18 000 x g to remove cell debris ...
-
bioRxiv - Genetics 2023Quote: Stable lines of phNPCs containing pTRIPZ-mir-4707-EGFP or pTRIPZ-control were plated at 4.5x105 and 1.5x104 cells/well in Matrigel-coated 6-well and 96-well plates respectively in 1x differentiation media: Neurobasal A (Life Technologies 10888-022) with 1x Antibiotic- Antimycotic (Life Technologies 15240-062) ...
-
bioRxiv - Microbiology 2022Quote: ... and blocked for 45 min in 2% bovine serum albumin (BSA) in PBS prior to staining with DAPI (4=,6-diamidino-2-phenylindole) and mounted in Prolong Diamond antifade (Molecular Probes, Life Technologies). Images were captured using a Nikon Eclipse Ti confocal microscope (Nikon Instruments ...
-
bioRxiv - Genetics 2023Quote: ... and heart from 6 wild-type crucian carp at 4-month-age were dissected for total RNA extraction using Trizol (Thermo Fisher, CA, USA). RNA quality was measured using Nanodrop 8000 (Thermo Fisher ...
-
bioRxiv - Immunology 2023Quote: ... the debris spot was generated by adding 6 μL of the solution containing the necrotic hepatocytes into an 8-well chamber slide (Nunc, Rochester, NY, USA) and drying for 2 hours in the laminar flow ...
-
bioRxiv - Immunology 2023Quote: ... We isolated CD4 T cells from pooled spleen and lymph nodes of 6-8-week-old Foxp3IRES-GFP mice using magnetic negative selection using the Dynabeads Untouched Mouse CD4 Cells Kit (ThermoFisher Scientific, cat#11415D), resting cells for at least 30 min at 4°C prior to electroporation ...
-
bioRxiv - Immunology 2023Quote: ... except for Fig 6 and Fig 7 which the recovered cells were counted by inclusion of counting beads (Accu-Check, Molecular Probes, Thermo Fisher Scientific) in the FACS sample according to manufacturer’s instructions and calculated using the equation ...
-
bioRxiv - Microbiology 2023Quote: iSLK-RGB-BAC16 cells seeded in 6-well plates at 50% confluency for 24 h were transfected with siRNAs with lipofectamine RNAiMAX (Thermo Fisher Scientific, 13778150). The knockdown efficiency was confirmed by reverse transcription real-time quantitative PCR (RT-qPCR ...
-
bioRxiv - Neuroscience 2023Quote: ... and seeded at nine thousand cells per well into a 96 well v-bottomed ultra-low attachment plate (S-Bio MS-9096VZ) in recovery media (6 μM Y27632 (Fisher Scientific ACS-3030) in mTeSR+) ...
-
bioRxiv - Cell Biology 2023Quote: ... We seeded 150 μL of zoospores suspended in Bonner’s salts into a single well of a 6-well glass bottom plate (Fisher Scientific, Cat. No. NC0452316) and allowed the cells to settle for 10 min before gradually applying confinement by decreasing the pressure from -3 kPa to -10 kPa.
-
bioRxiv - Cancer Biology 2024Quote: ... Samples were then transferred to an ultra-low attachment 6-well culture plate to be cultured in GBO culture medium containing 50% Neurobasal (Thermo Fisher Scientific, 21103049), 50% DMEM:F12 (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... Magnetic bead removal and the evaluation of CAR expression on T cells by flow cytometry were performed on day 6 by staining with a goat anti-mouse F(ab’)2 antibody (Invitrogen, Carlsbad, CA, USA). CART cells were harvested and cryopreserved on day 8 for future experiments ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were seeded at a density of 106 cells/well or 8×105 cells/well in a 6-well or 96-well tissue culture plate (Nunc; Thermo Fisher Scientific), respectively ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... After incubation with the secondary antibody slices were washed three times for 6 min in PBS and mounted on microscopic slides covered with mounting dye with DAPI (Invitrogen, 00-4959-52).
-
bioRxiv - Neuroscience 2023Quote: ... Transcript levels of candidate genes were measured by qRT-PCR using cDNA with the QuantStudio 6 Flex Real-Time PCR System (Life Technologies, Darmstadt, Germany) according to the company’s guidelines.
-
bioRxiv - Molecular Biology 2023Quote: Real-time PCR was performed as reported previously (Tan et al., 2019) using the QuantStudio 6 Flex Real-Time PCR System (ABI, Thermo Fisher, Shanghai, China) and Roche LightCycler® 480 (Roche ...
-
bioRxiv - Bioengineering 2023Quote: ... The slides were thoroughly rinsed and sealed utilizing a SlowFade Gold antifade reagent with 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen, Thermo Fisher Scientific) and coverslips.44 The stained slides were imaged at 4x magnification with an EVOS fluorescence imaging system.
-
bioRxiv - Genetics 2024Quote: ... cell pellets were resuspended into PBS with 2% FBS and 1µg/ml of 4’,6-diamidino-2-phenylindol (DAPI) (Thermo Fisher Scientific, Cat#D1306) and transferred into 5 ml round bottom polystyrene flow tubes with cell strainer (Corning Life Sciences ...
-
bioRxiv - Developmental Biology 2024Quote: ... Dissociated cells were blocked in 6% BSA and immunolabeled with anti-α3 antibody (mouse Anti-ATP1A3 xVIF 9-G10, MA3-915, Invitrogen, Thermo Fisher scientific) for 2 hours 200 times in PBS1x containing 1%BSA or at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... A total volume of 10µl per reaction was run on a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems Thermo Fisher Scientific, 4485691) for 45 cycles (2 minutes at 50 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... and mouse (n=6; kept on HFD for 28 weeks) livers were measured with the GeneChipTM miRNA 4.0 Array (Applied Biosystems, Foster City, US).
-
bioRxiv - Cell Biology 2024Quote: Total RNA was extracted from hind limb muscle of adult extensor digitorum longus (3-6 months) or newborns (P0) with TRIzol reagent (Thermo Fisher Scientific, 15596026) (41 ...
-
bioRxiv - Genetics 2024Quote: ... and TaqMan Assay probes were loaded in technical quadruplicates for qRT-PCR on a QuantStudio 6 Flex Real-Time PCR System (Thermo Fisher Scientific, 4485691). The ΔΔCt method was used to provide gene expression values after normalizing to the known reference gene Gapdh ...
-
bioRxiv - Cell Biology 2024Quote: ... Cell aggregates were transferred into ultra-low attachment 6-well plates in Complete KSR EB medium (KnockOut™ SR (Life Technologies, #10828-028) 20% ...
-
bioRxiv - Cell Biology 2024Quote: ... tissues from 6 different zebrafish were pooled in each condition and we used TriZol protocol to extract total RNA (Invitrogen, Carlsbad, California, USA). The protocol conditions for sample preparation and quantification have been previously detailed (Seiliez and al ...
-
bioRxiv - Neuroscience 2024Quote: ... After incubation with the secondary antibody sections were washed three times for 6 min in PBS and mounted on microscopic slides covered with mounting dye with DAPI (Invitrogen, 00-4959-52).
-
bioRxiv - Cell Biology 2024Quote: ... RPE1 cells stably expressing dCas9-GFP-3xFKBP were seeded in 6 well plates (120 000 cells/well, Thermo Fisher Scientific, Waltham, MA, USA) the day before lentivirus transduction ...
-
bioRxiv - Bioengineering 2024Quote: ... 25 µg of proteins were separated in each well using 6% sodium dodecyl sulfate-polyacrylamide gel electrophoresis gel with pre-stained molecular weight markers (ThermoFisher St. Louis, MO) and transferred to PVDF (polyvinylidene ...