Labshake search
Citations for Thermo Fisher :
4201 - 4250 of 10000+ citations for 1 6 Bismaleimidoethane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... The protein pellets were resuspended in 6 M guanidine solution prepared in 100 mM triethylammonium bicarbonate (TEAB) buffer (Thermo Scientific, Cat# 90114). The protein solutions were reduced with 5 mM dithiothreitol (DTT ...
-
bioRxiv - Neuroscience 2022Quote: ... Acute transverse hippocampal slices (250 µm) from wild-type C57BL/6 mice were prepared on a vibratome (Microm HM600V, Thermo Scientific, France) in ice-cold dissecting solution containing (in mM) ...
-
bioRxiv - Neuroscience 2022Quote: ... C57BL/6 P4-5 mice pups were rapidly decapitated and brains were processed in Hibernate-A medium (Thermo Fisher Scientific, A12475-01). Resulting tissue was enzymatically disassociated in buffer containing HEPES-HBSS with DNase (Worthington Biochemical LS002007 ...
-
bioRxiv - Neuroscience 2022Quote: Quantitative RT-PCR was performed using Taqman Gene Expression Assays and Taqman Fast Advanced Mastermix on a QuantStudio 6 Flex system (Thermo Fisher Scientific). Relative gene expression was determined via the ΔΔ-ct method normalised to GAPDH (human tissue) ...
-
bioRxiv - Neuroscience 2022Quote: ... Human iPSCs were plated onto 6-well dishes coated with Matrigel (Thermo-Fisher Scientific; Waltham, MA, USA; Cat. No. 08-774-552) in mTeSR1 medium (STEMCELL Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: 100,000 LX2 or 20,000 RAW cells were seeded in 6- and 12-well tissue culture plates and allowed to grow for 24h in DMEM (GIBCO, Life Technologies) containing 10% FBS and antibiotics ...
-
bioRxiv - Neuroscience 2022Quote: ... and 12 old (21 months) male C57BL/6 animals (combined over 2 independent experiments) were intraperitoneally injected with 5-ethynyl-2’- deoxyuridine (EdU) (Fisher Scientific, A10044) (resuspended in PBS at 5 mg/mL ...
-
bioRxiv - Neuroscience 2022Quote: DRG were harvested from thoracic spinal levels of adult Pvalbcre;Rosa26Ai14 and Pirtcre;Scn1a-floxed (6-16 weeks) mice of both sexes and transferred to Ca2+-free and Mg2+-free HBSS solution (Invitrogen, 14170-112). Upon isolation ...
-
bioRxiv - Microbiology 2022Quote: ... After 2 washes with 1xPBS, the cell nuclei were stained with NucBlue Fixed Cell Stain ReadyProbes Reagent (4’,6-diamidino-2-phenylindole, DAPI) (Thermo Fisher Scientific) for 30 min in the dark at RT ...
-
bioRxiv - Developmental Biology 2022Quote: ... NC cells were aggregated into 3D spheroids (5 million cells/well) in Ultra Low Attachment 6-well culture plates (Fisher Scientific, 3471) and cultured in Neurobasal (NB ...
-
bioRxiv - Cell Biology 2022Quote: ... myotubes were transfected with 1µg of the MHC I (H2-kb) overexpression plasmid using Lipofectamine™ 2000 reagent for a period of 6 hours (Invitrogen, USA), both without and with the addition of the ER stress blocking agent ...
-
bioRxiv - Cell Biology 2023Quote: ... of samples were pooled and separated into 6 fractions by off-line basic reversed-phase (bRP) using the Pierce High pH Reversed-Phase Peptide Fractionation Kit (Thermo Fisher Scientific). The fractions were collected in 7.5 ...
-
bioRxiv - Plant Biology 2024Quote: ... Quantitative PCR was performed with specific primers (Supplemental Table S4) using the QuantStudio 6 Flex Real-Time PCR System (Thermo Fisher Scientific) and cycling conditions for PCR were 50°C for 2 min ...
-
bioRxiv - Microbiology 2024Quote: ... Single-axis tilt series were collected covering an angular range from -65° to +65° or -60° to +60° at 6- to 8-μm underfocus using the Tomography software package (Thermo Fisher Scientific). Subtomogram averaging was done the eman 2.99 software package ...
-
bioRxiv - Cell Biology 2024Quote: ... The resulting cDNA was then used for real-time qPCR with the Taq Pro Universal SYBR qPCR Master Mix (Vazyme, Q712-02) using the Quant Studio™ 6 Flex Real-Time PCR system (Thermo Fisher). The mRNA levels of GAPDH or actin were used as an internal control to normalize the mRNA levels of genes of interest ...
-
bioRxiv - Genomics 2024Quote: Probes were hybridized to the sample at a concentration of 6-10 µM in a 30% v/v formamide (Fisher Scientific, AM9342), 10% w/v dextran sulfate (VWR ...
-
bioRxiv - Neuroscience 2024Quote: ... wells were washed with PBS and a 2 nM mix of PS129 conjugated to Alexa Fluor 488 and Alexa Fluor 647 (ThermoFisher, A20181/6) applied for 3 hours ...
-
bioRxiv - Neuroscience 2024Quote: ... Sciatic nerves of 6 mouse pups between postnatal days 2 and 4 (P2 and P4) were collected in L15 medium (Thermofisher, Massachusetts, USA) and incubated for 30 min in 2 mg/mL collagenase II and then 10 min in 0.25 % trypsin containing EDTA at 37 °C ...
-
bioRxiv - Molecular Biology 2024Quote: Cells seeded at a density of 1.75×105 cells per well in a 6-well plate were transfected with 40 nM of pooled anti-IL6ST (cat# s7317, s7318, s7319; Thermo Fisher Scientific) or non-targeting Silencer Select siRNA (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... uteri were cut open and dissociated in 5mL Hanks’ Balanced Salt Solution (HBSS) containing 6 mg/mL dispase (Thermo Fisher, Waltham, MA) and 1% (w/v ...
-
bioRxiv - Plant Biology 2023Quote: All RT-qPCR experiments were performed on an Applied Biosystems QuantStudio 6 system in 96- well plate format using PowerUp SYBR Green Master Mix (ThermoFisher, cat#A25741). Prior to use in experiments ...
-
bioRxiv - Biophysics 2024Quote: Quantitative determination of intracellular pH (pHi) was performed using the cell-permeant ratiometric pH indicator SNARF™-5F 5-(and-6)-carboxylic acid AM (Thermo Fisher) in live imaged N2a cells at 48 hours of differentiation ...
-
bioRxiv - Developmental Biology 2024Quote: ... Sucrose gradient fractions were monitored at 254 nm absorbance on an UA-6 UV/VIS detector (Teledyne Isco Inc., Lincoln, NE) and collected in individual tubes containing TRIzol LS (Ambion, Austin, TX).
-
bioRxiv - Immunology 2024Quote: Individual cytokines in supernatants from cell culture experiments were measured using the species-appropriate ELISA Kits mouse IL-6 (Invitrogen™ 88706488), mouse IL-1beta (Invitrogen™ 88701388) ...
-
bioRxiv - Genomics 2024Quote: TSCs wild-type and CRISPR-Cas9 edited cells were grown separately in wells of a 6-well plate and harvested at 80% confluency (∼2e6 cells) using 500 μl of TRIzol reagent (Life Technologies Corp). The lysate was incubated for 5 min on ice ...
-
bioRxiv - Immunology 2024Quote: ... the membranes were stripped for 6 minutes at RT using a Restore Western Blot Stripping Buffer (#21059; Thermo Scientific, Waltham, MA, USA), blocked ...
-
bioRxiv - Biochemistry 2023Quote: ... 6 μL was injected onto an Acclaim PepMap 100 column packed with 2 cm of 5 μm C18 material (Thermo Fisher, 164564) using 0.1% formic acid in water (solvent A) ...
-
bioRxiv - Cell Biology 2024Quote: Live microscopy imaging was performed on cells in 6-weel or 24-well plates using EVOS FLoid Imaging System (Thermo Fisher Scientific) equipped with 20x objective or Eclipse TS100 (Nikon ...
-
bioRxiv - Biophysics 2023Quote: ... These grids were blotted with filter paper for 3∼6 s (100% humidity at 4 °C) in a Vitrobot Mark IV (Thermo Fisher Scientific) and vitrified in liquid ethane at liquid nitrogen temperature ...
-
bioRxiv - Cancer Biology 2023Quote: LN-229 cells were seeded at 2×10^5 cells/well into in 6-well Nunc™ Cell-Culture Treated Multidishes (ThermoFisher, #140675) and incubated overnight in reduced serum media at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 × 105 cells were seeded in 6-well plates and immediately transfected with a mixture of 10 μL Lipofectamine2000 (Thermo Fisher Scientific), 6 μL of 20 μM target-specific siRNA (or non-targeting siRNA as control) ...
-
bioRxiv - Immunology 2023Quote: PPQ cells grown in 6-well plates were transfected with 100 nM control or cGAS siRNA (Dharmacon) by RNAiMax (Thermo Fisher Scientific). cGAS knockdown was confirmed by western blot three days later ...
-
bioRxiv - Microbiology 2023Quote: ... Gene expression was quantified on QuantStudio 6 PRO Real-Time PCR System using PowerUp™ SYBR™ Green Master Mix (Applied Biosystems) and gene-specific primers (Table S4) ...
-
bioRxiv - Biochemistry 2023Quote: The total RNA from mouse liver or Hepa1-6 cells was extracted using ISOGEN (Nippon Gene) and reverse-transcribed using High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... Quantitative PCR was performed on an Applied Biosystems QuantStudio 6 Flex Real-Time PCR System using Fast SYBR Green Master Mix (Applied Biosystems, #4385612). The relative gene expression was calculated using the 2−ΔΔCt method with GAPDH as endogenous control for normalization.
-
bioRxiv - Molecular Biology 2023Quote: ... Blood cells were mixed with 6 mls of PBS and 25 mls of this cell suspension was layered on 18 mls of Ficoll-Paque (Fisher Scientific, 17144003) and spun down for 35 mins at 400 x g at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... 1×105 cells were seeded in 6-well plates overnight and transfected with 20-25 pmol of the indicated siRNAs using Lipofectamine 3000 (ThermoFisher Scientific, 13778030) following the manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: ... the coverslips were washed with PBS three times before being mounted using ProLong™ Diamond Antifade Mountant with 4′,6-diamidino-2-phenylindole (DAPI; Life Technologies). Images were obtained with Olympus BX61 fluorescence microscope or Zeiss LSM800 laser confocal scanning microscope and processed using cellSens imaging software (Olympus ...
-
bioRxiv - Neuroscience 2023Quote: ... Two clean 6 mm sapphire disks (Technotrade Inc 616-100) were placed per well of 12- well tissue culture plate (Fisher Scientific 720081) and coated with poly-D-lysine (1 mg/ml ...
-
bioRxiv - Cancer Biology 2023Quote: ... The cDNA was amplified with ChamQ SYBR qPCR Master Mix (Q311-02; Vazyme, China) using Quant Studio 6 Flex RealLTime PCR System (Life Technologies, USA). The expression values of the target gene were normalized according to the reference gene (GAPDH) ...
-
bioRxiv - Microbiology 2023Quote: ... After the secondary antibody was washed three times for 5 min, nuclei were stained with DAPI (4’,6- Diamidino-2-Phenylindole, Dihydrochloride) (#D1306, Thermo Fisher Scientific) (dilution 1:1,000 in PBS ...
-
bioRxiv - Cell Biology 2023Quote: Cells were seeded onto 6-well plates or 35-mm dishes and transfected at 70–80% confluence with Lipofectamine RNAiMax (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... qPCR was performed using a PowerUp SYBR Green Master Mix and standard protocols on an Applied Biosystems QuantStudio 6 Real-Time PCR System (Thermo Fisher Scientific). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were transfected with 30 pmol of target gene or control siRNA directly after replating on the 6 cm culture plate using Lipofectamine® RNAiMAX (#13778-075, Thermo Fisher), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... sections were stained with 4′,6-diamidino-2-phenylindole (DAPI) for 10 min and mounted using SlowFade Diamond Antifade Mountant with DAPI (Invitrogen, Cat# S36964). Slides were imaged using a Nikon Y-FL microscope attached to a Nikon DS-Qi2 camera and images were captured using NIS elements AR software ...
-
bioRxiv - Neuroscience 2023Quote: ... larvae were visually screened for the expression of single or sparsely labelled FoxP2.A:FingR(PSD95)+ neurons in the tectum using a 20x water-immersion objective and an LSM 980 confocal microscope with Airyscan 2 (Zeiss) and placed into individual wells of a 6-well plates (Thermo Fisher Scientific) to keep track of individual larvae and the corresponding labelled neurons ...
-
bioRxiv - Neuroscience 2023Quote: ... The organoids were quickly transferred into the cold Expansion Medium with Geltrex™ and re-plated into a fresh Pluronic™ F-127-coated 6-well dish (Cat# 140685, ThermoFisher).
-
bioRxiv - Zoology 2023Quote: ... Total RNA was extracted from the pooled intestine tissues of 6 fish in each pond above using TRIzol Regent (Thermo Fisher, USA). Primers were designed based on the coding sequences of these genes from large yellow croaker genome database (Ao et al. ...
-
bioRxiv - Developmental Biology 2023Quote: ... Pax-6 and Nkx6.1 (Developmental Studies Hybridoma Bank, Univ. of Iowa) were detected with AlexaFluor labeled secondary antibodies (Life Technologies, Waltham, MA).
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).