Labshake search
Citations for Thermo Fisher :
4201 - 4250 of 10000+ citations for Aldosterone Chemiluminescent ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2023Quote: ... one lung section 5×5×5 mm in size was finely cut and stored at -20°C in RNAlater (Thermo Scientific, US). We mechanically disrupted the tissue from RNAlater using a MediMachine (BD Biosciences ...
-
bioRxiv - Biophysics 2020Quote: ... 30,000 cells were seeded into a 24-well plate (NuncMicroWell Plates with Nunclon; Thermo Fisher Scientific, Waltham, MA). Transfection was carried out at day 1 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Ninety-six-deep well plates and 500 cm2 cell culture plates were purchased from Fisher Scientific (Loughborough, UK). Millipore 96-well GF/B filter plates were purchased from Receptor Technologies (Warwick ...
-
bioRxiv - Microbiology 2020Quote: ... and vancomycin in Mueller-Hinton broth using sensititre plates EUVENC Sensititre® plates (Thermo Fisher Scientific, Waltham, USA) and home-made 96-well microtiter plates for levofloxacin following the CLSI guidelines (19).
-
bioRxiv - Immunology 2021Quote: ... to each well and the plates read at 450 nm using a Multiscan FC Plate Reader (Thermo Scientific). ELISA results were presented as normalised OD450 with the mean OD450 values of blank wells subtracted from the sample well values.
-
bioRxiv - Cell Biology 2023Quote: ... 800,000 cells were seeded into a 6-well plate (NuncMicroWell Plates with Nunclon; ThermoFisher Scientific, Waltham, MA, USA). At day 0 the transfection was done ...
-
bioRxiv - Microbiology 2023Quote: ... and 20 µl of the samples were distributed into 96-well plates (V-bottom storage plates, Thermo Scientific). Additionally ...
-
bioRxiv - Microbiology 2023Quote: ... cells and supernatants or of mGAM were distributed into 96-well plates (V-bottom storage plates, Thermo Scientific) according to drug-treatment concentration ...
-
bioRxiv - Immunology 2024Quote: ... Ninety-six well polystyrene plates NUNC MaxiSorp™ or NUNC 384-Well Clear polystyrene plates (Thermo Fisher Scientific) were coated with 2,4-dinitrophenyl conjugated to BSA (DNP-BSA ...
-
bioRxiv - Cell Biology 2020Quote: Proliferation was assessed through incorporation of 5-ethynyl-2’-deoxyuridine (EdU) using the Click-iT EdU Alexa Fluor 488 Flow Cytometry Assay Kit (Invitrogen, C10425). One day prior to harvest ...
-
bioRxiv - Genetics 2020Quote: ... cDNA was synthesised from 5 µg RNA using random hexamer primers and the RevertAid H Minus First Strand cDNA Synthesis kit (Thermo Scientific).
-
bioRxiv - Developmental Biology 2020Quote: ... Each primer contains a T7 sequence at its 5’ end for use with the MEGAshortscript T7 transcription kit (Thermo Fisher Scientific). The reaction was placed in boiling water and allowed to cool to room temperature to promote annealing ...
-
bioRxiv - Molecular Biology 2021Quote: ... a DNA oligo template (5’ TAATACGACTCACTATAGGGACACAAAACAAAAGACAAAAACACAAAACAAAAGACAAAAACA CAAAACAAAAGACAAAAAGCCTCTCCTTCTCTCTGCTTCTCTCTCGCTGTGTGCGTACAACTAGCT 3’) was PCR-amplified and then in vitro transcribed using the MEGAshortscript™ T7 Transcription kit (Invitrogen). An 11:7 ratio of the helicase RNA substrate to 5’ Alex Fluor 488 fluorescent oligo strand (Alexa Fluor 488/ AGCTAGTTGTACGCACAC ...
-
bioRxiv - Molecular Biology 2021Quote: RNA was isolated from WT and MafAS64F/+ islets (n=4 for males, n=5 for females) using the RNAqueous total RNA isolation kit (Ambion; Thermo Fisher), and then analyzed on an Agilent 2100 Bioanalyzer ...
-
bioRxiv - Bioengineering 2022Quote: Primary neonatal cardiomyocytes were isolated from C57BL/6 mouse neonates on postnatal days 3-5 using the Pierce Primary Cardiomyocyte Isolation Kit (Thermo Fisher) as previously described (14) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5-ethynyl-2′-deoxyuridine (EdU) incorporation was detected using a Click-iT Plus EdU Alexa Fluor 555 Assay Kit (Invitrogen, C10638) prior to primary antibody incubation ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... the reverse transcription of 5 μL of extracts was carried out using the TaqMan™ MicroRNA Reverse Transcription Kit (ThermoFisher, USA) including the TaqMan RT 5 x primer (assay ID ...
-
bioRxiv - Neuroscience 2019Quote: The study of proliferation and differentiation of neural stem cells in the dentate gyrus was performed by incorporation of 5-ethynyl-2’-deoxyuridine (EdU, Click-iT EdU Imaging Kit; Molecular Probes) to allow the analysis of proliferation and differentiation ...
-
bioRxiv - Genomics 2019Quote: ... After dissociation of bead-bound RNA by heating (70°C, 5 min) cDNA synthesis was carried out using the Superscript VILO cDNA Synthesis kit (Invitrogen, 11754). RNA/cDNA hybrids were then incubated for 5 min at 85°C and quantification was carried out by qPCR with specific primer pairs (Fig ...
-
bioRxiv - Immunology 2019Quote: ... LDH assay was performed 16 hours after infection using 5·104 cells following manufacturer instructions (Pierce LDH Cytotoxicity Assay Kit, ThermoFisher Scientific).
-
bioRxiv - Cancer Biology 2019Quote: We performed chromatin immunoprecipitation (ChIP) on 4-5×106 MDA-LM2 or SUM-LM1 cells using the PierceTM Magnetic ChIP Kit (ThermoFisher Scientific) according to manufacturer’s instructions with 10 μg rabbit IgG isotype control or c-Jun antibody (Cell Signaling) ...
-
bioRxiv - Plant Biology 2020Quote: ... Rapid amplification of the 5’ and 3’ cDNA ends (RACE) was subsequently carried out by using the First Choice RLM-RACE kit from Ambion (USA), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... 5 µl of TaqMan® RT-PCR mix (TaqMan® RNA-to-CtTM 1-Step Kit) (Applied Biosystems, Waltham, MA, USA), 0.5 µl of TaqMan® RT-Enzyme Mix ...
-
bioRxiv - Plant Biology 2020Quote: ... cDNA was synthesised from 1-5 μg of template RNA using he Thermo Scientific RevertAid H Minus First Strand cDNA Synthesis Kit by Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Microbiology 2021Quote: ... A portion (5 µl) was kept to quantify the total amount of proteins using Pierce™ BCA protein assay kit (23225, ThermoFisher). 5 ml of HNO3 5% (Sigma ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Then cDNA were produced from 5 μL of total RNA using RT Superscript III (RT Superscript III First Strand cDNA Synthesis Kit; Invitrogen, Life Technologies) and random hexamer primers (50 ng ...
-
bioRxiv - Plant Biology 2020Quote: ... cDNA was amplified for each gene (Supplementary Table 5) using Takara PrimeSTAR GXL polymerase then subcloned into pJET1.2 using CloneJet PCR cloning kit (ThermoFisher, Meerbusch, Germany). For SWEET13a ...
-
bioRxiv - Microbiology 2020Quote: ... and purified RNA from 2 ml of cells harvested immediately before and 5 min after stress using the RiboPure™-Bacteria Kit (Ambion), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... and dissociated into single cells in 100 μl of Enzyme 1 and 5 μl of Enzyme 2 (Pierce Cardiomyocytes Dissociation Kit, ThermoFisher Scientific) for 30 min at 350 rpm shaking at 30°C ...
-
bioRxiv - Microbiology 2022Quote: Total RNA was isolated from 5 HIOs per group with a total of 4 replicates per condition using the mirVana miRNA Isolation Kit (Thermo Fisher). The quality of RNA was confirmed ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell lysates were cleared by centrifugation at 16,000 × g for 5 min at 4°C and protein concentration was determined using the Pierce BCA protein assay kit (Thermo Scientific). Cell lysates were mixed with Laemmli sample buffer (Alfa Aesar ...
-
bioRxiv - Developmental Biology 2019Quote: ... 5-ethynyl-2’-deoxyuridine (EdU) labeling was performed using the Click-iT EdU Alexa Fluor 647 Imaging Kit (Invitrogen Cat#C10340) following manufacturer instructions ...
-
bioRxiv - Genomics 2019Quote: ... Six μg of the isolated RNA was used for 5’- and 3’ RACE reactions with a FirstChoiceTM RLM-RACE Kit (ThermoFisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2019Quote: ... 5 μl diluted RT product was applied to each 10 μl qPCR reaction using the TaqMan Universal Amplification kit (ThermoFisher/AppliedBiosystems) with customized TaqMan probes (Hs.PT.58.21450367 for TCF4 ...
-
bioRxiv - Molecular Biology 2020Quote: ... We used two independent samples collected from independent infection assays to conduct 5’ RACE using the first choice RACE kit following the manufacturer’s protocol (Applied Biosystems, USA) without adding calf intestinal Phosphatase enzyme ...
-
bioRxiv - Physiology 2021Quote: ... laevis expression construct using pNB1uf/r primers (Supplementary Table 5) and cRNA was synthesized using the mMESSAGE mMACHINE™ T7 Transcription Kit (Invitrogen) according to the manufacturer’s manual.
-
bioRxiv - Genomics 2021Quote: ... Poly-adenylated RNAs were purified from 5 µg total RNA with the Dynabeads®Oligo (dT)25 Kit (Thermo Fisher Scientific) following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2021Quote: EdU (5-ethynyl-2′-deoxyuridine) detection was performed with the Click-iT EdU Alexa Fluor 555 Imaging Kit (Thermo-Fisher Scientific). EdU was diluted in DMSO to a final concentration of 10 mM ...
-
bioRxiv - Physiology 2021Quote: ... RNA targeting exon 3 of Ctns (gRNA-ex3 5’-ATCTTTCCAGAATCAACCGTCGG-3’) was produced using the Precision gRNA Synthesis Kit (Thermo Scientific). Online tools RGEN (http://www.rgenome.net/cas-designer/ ...
-
bioRxiv - Microbiology 2020Quote: ... RNA (5 μg per sample) was subjected to two rounds of mRNA enrichment using a MICROBExpress bacterial mRNA purification kit (Thermo Fisher). cDNA libraries with unique barcodes were generated from 100 ng enriched mRNA using NEB Next UltraII Directional RNA Library Prep kit for Illumina (New England Biolabs) ...
-
bioRxiv - Microbiology 2021Quote: Viral RNA was quantified using real the Genesig® Real Time PCR Coronavirus COVID-19 (CE IVD) kit (Primer Design) using the manufacturer’s protocol and QuantStudio 5 Real-Time PCR System thermocycler (Thermo Fisher Scientific)
-
bioRxiv - Molecular Biology 2020Quote: ... The cleavage site in the miR169 gene was verified by 5′ RLM-RACE using a FirstChoice® RLM-RACE Kit (Ambion) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was synthesized using all RNA available (or 1-5 ng) with the High-Capacity Reverse Transcription Kit with RNase Inhibitor (Life Technologies) (250 C for 10 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... were transfected using Lipofectamine 3000 kit (7.5 µl Lipo 3000 and 5 µl P3000 reagents per 6-well; Thermo Fisher Scientific) according to the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2022Quote: ... newly synthesized DNA was labeled using the Click-iT Plus 5-ethynyl-2’-deoxyuridine (EdU) Alexa Fluor 647 flow cytometry assay kit (ThermoFisher Scientific) according to manufacturer ‘s instructions ...
-
bioRxiv - Immunology 2022Quote: ... The cells were spun down (1500 rpm/5 minutes at room temperature) and stained with LIVE/DEAD™ Fixable Near-IR Dead Cell Stain Kit (Invitrogen) and Fc Block (BD ...
-
bioRxiv - Microbiology 2022Quote: ... These RNAs were 35 nucleotides long and they were prepared by in vitro transcription using a DNA template (5’-CAGTAATACGACTCACTATAGGGGAAGCGGGCATGCGGCCAGCCATAGCCGATCA-3’) and the TranscriptAid T7 high-yield transcription kit (Thermo Scientific). The reaction was performed in a 50-μl mixture containing 1× TranscriptAid reaction buffer ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were FACS sorted directly into 5 or 10μl Single cell lysis solution (SCLS; Single cell lysis kit Invitrogen, cat# 4458235) with DNase I according to manufacturer’s instructions with the exception that the lysis reaction was incubated for 15min at room temperature (RT ...
-
bioRxiv - Plant Biology 2024Quote: 5 μg of total RNA were first depleted of rRNA with the RiboMinus Plant Kit for RNA-Seq (Thermo Fisher Scientific). RNA was de-capped using Cap-Clip Pyrophosphatase ...
-
bioRxiv - Plant Biology 2024Quote: ... validations were performed using cDNA synthesised from 5 ng dNase-treated RNA (per qRT-PCR reaction) and a RT Maxima First Strand synthesis kit (Thermo Fisher), following the manufacturer’s instruction ...