Labshake search
Citations for Thermo Fisher :
4451 - 4500 of 10000+ citations for Aldosterone Chemiluminescent ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... into sterile 96-well plates (Fisher Scientific). The plates were incubated at 37 °C for 24 h in a Stratus microplate reader (Stellar Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... a 96-well plate (Nunc; Roskilde, Denmark) was coated with 50 μl of 10 μg/ml LPS from S ...
-
bioRxiv - Neuroscience 2023Quote: In a 96-well plate (ThermoFisher #165305), cells were plated at a density of 20,000 cells per well and grown to roughly 65% confluency before being treated with FEM-1689 overnight ...
-
bioRxiv - Developmental Biology 2024Quote: ... into 96 well PCR plates (Thermo Scientific) containing 2μl of lysis buffer (0.1% Triton X-100 ...
-
bioRxiv - Neuroscience 2024Quote: 384-well plates (M1937-32EA. Life Technologies) were coated with 50 µg/ml laminin in dH20 (Sigma ...
-
bioRxiv - Cell Biology 2024Quote: ... in 384 well PCR plates (Thermofisher, AB1384) using the QuantStudio™ 12K Flex Real-time PCR System instrument (Thermofisher) ...
-
bioRxiv - Immunology 2024Quote: ... plate reader or Labsystems Multiscan RC (ThermoFisher) at an optical density (OD ...
-
bioRxiv - Systems Biology 2024Quote: ... coated plates in StemFlex Medium (Gibco #A3349401) with 100ug/ml Primocin (Invivogen #ANTPM1) ...
-
bioRxiv - Cancer Biology 2024Quote: ... was immobilized on Maxisorp plates (ThermoFisher Scientific) overnight at 4 °C ...
-
bioRxiv - Neuroscience 2024Quote: 96-well plates (Nunc MaxiSorp, Thermo Scientific) were coated with CRMP5-GST (200 ng per well ...
-
bioRxiv - Neuroscience 2024Quote: ... coated plates using StemFlex medium (Thermo Fisher) and human motor neurons were derived based on a modified protocol for adherent cells 25 ...
-
bioRxiv - Neuroscience 2024Quote: 96-well plates (Nunc MaxiSorp, Thermo Scientific) were coated with CRMP5-GST (200 ng per well ...
-
bioRxiv - Biochemistry 2024Quote: ... coated plates in E8 medium (ThermoFisher Scientific) and kept at 37 °C and 5% CO2 ...
-
bioRxiv - Immunology 2024Quote: Reacti-Bind plates (Thermo Scientific, cat. 15041) were coated overnight at 4°C with either 0.75 μg/ml anti-rhodopsin antibody (clone 1D4 ...
-
bioRxiv - Microbiology 2024Quote: ... In a white 96 well plate (NUNC) with optical bottom ...
-
bioRxiv - Microbiology 2024Quote: In a white 24-well plate (NUNC), 105 HeLa cells were seeded in 350 μl DMEM (Gibco) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 96-well plates (Thermo Fisher Scientific, 442404) were coated with 1 μg/mL of anti-hFIX antibody (Sigma ...
-
bioRxiv - Microbiology 2024Quote: ... using a magnetic stir plate (Thermo Fisher) set at 65 rpm ...
-
bioRxiv - Neuroscience 2024Quote: ... on plates coated with Geltrex (Gibco, A1413301). iPSCs were differentiated into i3Neurons as described before (Tian et al. ...
-
bioRxiv - Microbiology 2024Quote: ... A 96-well immuno-plate (Nunc Maxisorp) was coated with 2 μg/mL of anti- toxin A rabbit polyclonal antibody (Abcam ...
-
bioRxiv - Microbiology 2024Quote: A 96-well immuno-plate (Nunc Maxisorp) was coated ON with CdtB capture antibody (MBS396782 ...
-
bioRxiv - Microbiology 2021Quote: ... Supernatants were assayed for IL-2 by enzyme-linked immunosorbent assay (ELISA) according to the manufacturer’s instructions (Thermo fisher). For flow cytometry ...
-
bioRxiv - Neuroscience 2020Quote: ... Cell culture supernatants were analyzed in duplicates on Ab40 and Ab42 colorimetric ELISAs per manufacturer’s protocol (KHB3481 and KHB3544, Invitrogen). Ab concentrations were normalized per total cell protein concentrations ...
-
bioRxiv - Neuroscience 2020Quote: ... was added to the plate after which a colour reaction was generated by incubation with TMB (3,3’,5,5’-tetramethylbenzidine) colorimetric substrate (1-Step Ultra TMB-ELISA Substrate Solution, ThermoFisher Scientific). The reaction was stopped with 2 M H2SO4 and the plate read at 405nm with a Tecen Infinite M1000 plate-reader ...
-
bioRxiv - Biochemistry 2022Quote: ... followed by three washes in 1% BSA and incubation with TMB-ELISA substrate (Thermo Fisher Scientific, Cat. no. 34028) until the light blue color appeared ...
-
bioRxiv - Biochemistry 2021Quote: ... Binding was visualized through the addition of 50 µL 1-Step™ Ultra TMB-ELISA Substrate Solution (ThermoFisher, #34028), incubated in the above plate shaker for approximately 5 minutes ...
-
bioRxiv - Neuroscience 2022Quote: Serum samples from dams were analyzed via enzyme linked immunosorbent assay (ELISA) for IL6 and TNFα (Thermo Fisher Scientific) following manufacturer’s recommendations.
-
bioRxiv - Immunology 2022Quote: ... OSP and CT ELISAs were then blocked with warm 200 µl/well of R10 media (RPMI + L-Glutamate (Gibco), 10% fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2019Quote: Serum IL-6 and IL-17A concentrations were assessed by ELISA according to the manufacturer’s instructions (Thermo Fisher Scientific).
-
bioRxiv - Immunology 2020Quote: The concentration of cytokines in the 24h and 48h supernatants from the T57 T cell activation assay was measured by ELISA according to the manufacturer’s instructions (IFNγ: Invitrogen eBioscience, cat#88731477, IL-2: Invitrogen eBioscience ...
-
bioRxiv - Immunology 2020Quote: The concentration of cytokines in the 24h and 48h supernatants from the T57 T cell activation assay was measured by ELISA according to the manufacturer’s instructions (IFNγ: Invitrogen eBioscience ...
-
bioRxiv - Microbiology 2019Quote: ... After 4 washes with PBS 0.01% v/v Tween-20 and 2 washes with ELISA Light washing buffer (ThermoFisher), CSPD substrate with Sapphire II enhancer (ThermoFisher ...
-
bioRxiv - Cell Biology 2021Quote: ... The color reaction was started by adding 100 μL of One-step Ultra TMB ELISA substrate (Thermo Scientific #34028) was added to each well (100 μL) ...
-
bioRxiv - Physiology 2021Quote: ... slgA concentrations in saliva were measured using the ready-set-go ELISA system for human IgA (Affymetrix: eBioscience, USA) with a sample dilution of 1:7500 at the University Hospital RWTH Aachen (SI ...
-
bioRxiv - Immunology 2022Quote: ... A volume of 25 μL/well of 1-step Ultra TMB-ELISA Substrate Solution (Thermo Fisher Scientific, cat. # PI34029) was added to the plates and incubated for 5 to 10 min at RT ...
-
bioRxiv - Immunology 2022Quote: ... Supernatants were collected for cytokine profiling by quantitative ELISA for IFNγ and IL-17A as per manufacturer’s instructions (Invitrogen). Prior to flow cytometric analysis for cytokine production ...
-
bioRxiv - Pathology 2023Quote: ... CCL2 levels were measured in conditioned media by ELISA (Invitrogen, cat nos. 88-7391-88 and 88-7399-88).
-
bioRxiv - Biochemistry 2023Quote: ... followed by the development of signal by treating cells with 200 μl TMB-ELISA (Thermo Scientific, Cat no. 34028) until the light blue colour appeared ...
-
bioRxiv - Cell Biology 2023Quote: Human ApoE protein was quantified using the Invitrogen Human ApoE ELISA following the manufacturers guidelines (Invitrogen. Cat no. EHAPOE).
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Plant Biology 2024Quote: ... using primers GtEFF1 (5’-CCCTGCAAGCTCTTCCTCTTAG-3’) and GtEFR1 (5’-GCATGCGAGGTCCCAAAA-3’) with the TaqMan probe (5’-6FAM-ACTGCACAGACCATC-MGB-3’) (Thermo Scientific™, USA) (Keenan et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... Incubation in prehybridization buffer (5× sodium saline citrate buffer [SSC], 5× Denhardt’s solution [ThermoFisher Scientific] ...
-
bioRxiv - Biophysics 2019Quote: ... 5 μL of 5 mg/mL streptavidin-labeled with Alexa Fluor 488 (ThermoFisher Sci.) was added for 30 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... sense 5’-CAAAGGACAACUGUCAGACACAGAA-3’ and antisense 5’-UUCUGUGUCUGACAGUUGUCCUUUG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2021Quote: Oligonucleotides ssDNASel25 (5’GGACAGGAAUUAAUAGUAGCUGUCC3’) and FITC(5’)-ssDNASel25 oligonucleotides were obtained from Invitrogen (USA), Cy5-DNA (5’ Cy5-AAACTATTATTACTCATTTTCCGCCAGCAGTCAACTTCGATTTAATTCGTAAACAGATCT3’ ...
-
bioRxiv - Bioengineering 2022Quote: ... 5% CO2 and 5% O2 in Essential 8 medium (Thermo Fisher Scientific, Waltham, MA) on Matrigel- (BioStrategy ...
-
bioRxiv - Biochemistry 2022Quote: 5 μM purified PWWP domain was incubated with 5× SYPRO Orange (Thermo Fisher Scientific) in assay buffer (20 mM Tris-HCl ...
-
bioRxiv - Bioengineering 2022Quote: ... stained with 5 μM DRAQ5 (Thermo Scientific, nuclear dye, 5 minutes at 37°C), fixed in 4% paraformaldehyde for 20 minutes ...
-
bioRxiv - Biochemistry 2022Quote: 5 μg of purified protein was mixed with 5× SYPRO orange (Thermo Fisher Scientific) in 20 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Immunology 2021Quote: ... and 5’ Rapid amplification of complementary DNA (cDNA) ends (5’RACE, Invitrogen, 18374-058) method as described previously20,21 ...