Labshake search
Citations for Thermo Fisher :
4101 - 4150 of 10000+ citations for Aldosterone Chemiluminescent ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... containing 5% FBS (Invitrogen), 5% horse serum (HS ...
-
bioRxiv - Cell Biology 2022Quote: ... 5% FBS (Gibco, #A3160802) and 1% penicillin/ streptomycin (pen/ strep ...
-
bioRxiv - Cell Biology 2023Quote: ... 5% horse serum (Invitrogen), 20 ng/ml EGF (PeproTech) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 mM MgCl2 (ThermoFisher), 20mM Tris-HCl pH 7.8 (ThermoFisher) ...
-
Phosphorylation controls spatial and temporal activities of motor-PRC1 complexes to complete mitosisbioRxiv - Biochemistry 2023Quote: ... 5% Penicillin/Streptomycin (Gibco) and 2.5 mM L-Glutamine at 37°C in a humidified atmosphere with 5% CO2 ...
-
bioRxiv - Microbiology 2023Quote: ... containing 5% EDTA (Invitrogen) route in accordance with IACUC guidance ...
-
bioRxiv - Biophysics 2023Quote: ... 5 mM EDTA (ThermoFisher), 1% nonidet P-40 (ThermoFisher) ...
-
bioRxiv - Genetics 2023Quote: ... 5 mM EDTA (Invitrogen), 200 mM NaCl (Invitrogen) ...
-
bioRxiv - Genomics 2023Quote: ... 5% FBS (Life Technologies), 0.4 ug/mL Hydrocortisone (Sigma-Aldrich) ...
-
bioRxiv - Genomics 2023Quote: ... 5-FU (Fisher Scientific), cytosine (Fisher Scientific) ...
-
bioRxiv - Genomics 2023Quote: ... 5% FBS (Life Technologies), 10 ng/mL human recombinant EGF (ThermoFisher) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cytokeratin 5 (AB_2538529, Thermofisher), Cytokeratin 8 (ab53280 ...
-
bioRxiv - Biochemistry 2023Quote: ... + 5 % FBS (Gibco #10500064) under antibiotic pressure using 5 μg/ml blasticidin (Gibco #A1113903 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5% horse serum (Invitrogen) and 0.3% Triton X-100 (Sigma ...
-
bioRxiv - Genomics 2023Quote: ... 5 mM DTT (Invitrogen), 1 M betaine (Sigma) ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 mM EDTA (ThermoFisher), 1% nonidet P-40 (ThermoFisher) ...
-
bioRxiv - Neuroscience 2024Quote: ... DTT (5 mM, Invitrogen), RNaseOUT (40 U ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 mM dithiothreitol (Invitrogen), 500 nM FSE primer CTTCGTCCTTTTCTTGGAAGCGACA (Integrated DNA Technologies) ...
-
bioRxiv - Cell Biology 2024Quote: ... The RT-PCR reactions were performed by ABI QuantStudio 5 (Applied Biosystems) using 5 µL of PowerUp SYBR Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2024Quote: ... 5% B27 supplement (Gibco) and 5% Fetal Bovine Serum (FBS ...
-
bioRxiv - Plant Biology 2020Quote: ... GSTU7-V5 fusion was visualized with a 1:1 mix of SuperSignalTM West Pico and SuperSignalTM West Femto chemiluminescent substrates (Thermo Fisher Scientific, Waltham, MA).
-
Construction of a constitutively active type III secretion system for heterologous protein secretionbioRxiv - Synthetic Biology 2022Quote: ... The anti-FLAG antibody was subsequently detected with goat anti-mouse IgG (H+L) conjugated to horseradish peroxidase (HRP) to facilitate chemiluminescent detection (Invitrogen 32430, 1:1,000 dilution). Chemiluminescent signal was produced with Pierce ECL substrate (Thermo Scientific) ...
-
bioRxiv - Pathology 2022Quote: ... Membranes were washed (1x in TBS-T) and peroxidase activity was detected using SuperSignal™ West Pico PLUS Chemiluminescent Substrate (ThermoFisher Scientific, cat# 34580). Blots were developed using Amersham Imager 680 (GE Healthcare) ...
-
bioRxiv - Cell Biology 2021Quote: ... HRP conjugated secondary antibodies were then applied and the blots were developed using SuperSignal® West Femto Maximum Sensitivity Chemiluminescent Substrate (Thermo Fisher, Cat# 34094). The antibodies used were the following ...
-
bioRxiv - Cell Biology 2021Quote: ... Secondary antibodies were conjugated to horseradish peroxidase (HRP) and peroxidase activity was visualized using SuperSignal™ West Pico PLUS Chemiluminescent Substrate (Thermo Scientific cat# 34577). ImageJ software was used to quantify protein bands(51).
-
bioRxiv - Physiology 2021Quote: ... membranes were incubated with HRP-conjugated secondary antibodies at room temperature for 1 hour and developed using a SuperSignal™ West Pico PLUS Chemiluminescent Substrate (Thermo Fisher Scientific – 34580). Primary antibodies used were rabbit anti-phospho AKT (1:1000 ...
-
bioRxiv - Microbiology 2023Quote: ... These tubes were centrifuged for 5 min at 3000×g and were washed three times with PBS-T and finally resuspended in 50 µl/well chemiluminescent peroxidase substrate (Supersignal® West Pico ThermoFisher Cat No. 34077). The samples were then transferred to a reading plate ...
-
bioRxiv - Neuroscience 2023Quote: ... Blots were incubated with HRP-conjugated secondary antibodies at 1:10000 for 1h at room temperature (see Table S1 for suppliers) and developed with SuperSignal™ West Pico PLUS Chemiluminescent Substrate (ThermoFisher®, Waltham, US) on CL-X Posure™ X-ray films (34091 ...
-
bioRxiv - Cancer Biology 2023Quote: ... incubated in 1:20,000 secondary antibody (Goat Anti-Rabbit HRP) and visualized with SuperSignal West Atto Ultimate Sensitivity Chemiluminescent Substrate (Thermo Fisher Scientific, Waltham, MA, USA) on the iBright 1500 (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... membranes were again rinsed 3x for 15 min with PBS-T and revealed using STELLA 8300 imaging system (Raytest) after incubation with chemiluminescent substrate (Life Technologies, cat. no 34580). Proteins of interest were quantified using Image J software (Wayne Rasband ...
-
bioRxiv - Molecular Biology 2020Quote: ... the plate was then read at 450 nm using a Multiskan® EX plate reader (Thermo Scientific), and the data analysed in GraphPad Prism version 7.0c ...
-
bioRxiv - Bioengineering 2021Quote: ... Fluorescence readings were conducted using a Spectramax plate reader in a black-walled clear bottom plate (Nunc), with the excitation/emission for TO1 and TO3 being 510/535 nm and 637/658 nm ...
-
bioRxiv - Microbiology 2021Quote: ... pneumoniae (one colony per species per plate) were further sub-cultured on Sheep Blood Agar plates (ThermoFisher) and species identity confirmed by matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS ...
-
bioRxiv - Neuroscience 2021Quote: ... the plate was washed 4 times with PBST using a plate washer (Thermo Fisher Scientific Wellwash Versa), and anti-pTRKB antibody (1:1000 in the blocking buffer ...
-
bioRxiv - Plant Biology 2023Quote: Stratified seeds were germinated on square plates (100 mm × 100 mm square plates; Fisher Scientific; Cat#FB0875711A) containing sterile full-strength (1x ...
-
bioRxiv - Biochemistry 2024Quote: ... if a 96-well plate (SureSTARTTM WebSealTM 96-Well Microtiter Plate, SN: 60180-P210B, Thermo Fisher Scientific) was used for injection ...
-
bioRxiv - Biophysics 2023Quote: 6-well plate cell proliferation – Cells were seeded into 6-well plates (Fisher Scientific, 07-200-83) 150,000 cells/well and left at ambient temperature for 20 minutes to ensure homogeneous settling ...
-
bioRxiv - Microbiology 2023Quote: ... the plate was transferred to 20° C pre-cooled plate reader (Multiskan GO, Thermo scientific, Waltham, MA) and shaken slowly for 10 seconds ...
-
bioRxiv - Biochemistry 2019Quote: ... 5’-GMPS-pre-tRNAAsp was prepared by in vitro transcription in the presence of guanosine 5’-monothiophosphate (GMPS) and labeled by reaction with 5-iodoacetamido-fluorescein (5-IAF, Life Technologies) overnight at 37 °C to prepare Fl-pre-tRNA (37,38) ...
-
bioRxiv - Microbiology 2019Quote: ... falciparum strain 3D7 parasites were grown under 5% O2 and 5% CO2 in RPMI-1640 media supplemented with 5 g/L Albumax II (Life Technologies), 2 g/L sodium bicarbonate ...
-
bioRxiv - Cancer Biology 2020Quote: ... followed by sonication three times for 5 seconds with 5 seconds intervals at #5 (on dial) (Fisher Scientific 60 Sonic Dismembrator) on ice ...
-
bioRxiv - Cell Biology 2020Quote: ... reverse: 5’-GGGGTCGGGAGGAACGG-3’ (Macrogen, South Korea) and beta-actin forward: 5’-CCTGGTCGGTTTGATGTT-3’ and reverse: 5’-GTGCGACGAAGACGA-3’ (Invitrogen, USA). Data analysis was made in CFX ManagerTM Software (BioRad ...
-
bioRxiv - Evolutionary Biology 2022Quote: The purified RNA was used to amplify cDNA from the gUTRGFP template with the 5’ Cy-5 labelled pWP252fluor primer (5’ ATAACGGACTAGCCTTA 3’) using the standard Superscript III First-Strand Synthesis System (Thermo Fisher) with 3 µg of total RNA and elongating at 52.5°C for 60 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were cultured at 37 °C in a humidified incubator at 21% oxygen/5% CO2 or 5% O2/5% CO2 (HeraCell Tri-Gas, ThermoFisher Inc).
-
bioRxiv - Neuroscience 2020Quote: ... Human phospho-tau [pT181] was measured using a commercially available ELISA per manufacturer’s instructions (Thermo Fisher Scientific, KHO0631). Guanidine extracted supernatants of hippocampus homogenates described above were utilized for the pTau ELISA.
-
bioRxiv - Neuroscience 2020Quote: The level of Aβ in the tissue was assessed by ELISA as per the manufacturer’s instructions (KHB3442, Invitrogen). The resulting measurements were normalized for tissue weight.
-
bioRxiv - Neuroscience 2021Quote: ... were prepared for ELISAs by coating each well with 50ul of 1.5ug/ml HT7 monoclonal antibody (Thermo Fisher) the night before use ...
-
bioRxiv - Neuroscience 2020Quote: ... whole brain lysates were prepared as for ELISA and protein concentration determined using a BCA assay (Thermo Fisher). Wells were loaded with 30 µg of total protein which was resolved by SDS-PAGE under reducing conditions and transferred onto polyvinylidene difluoride (PVDF ...
-
bioRxiv - Neuroscience 2019Quote: ... and results of the ELISA were measured by a colorimetric microplate reader (VarioSkan 2.2; Thermo Scientific Inc., USA) at 450nm ...
-
bioRxiv - Pathology 2021Quote: ... After staining with 1-Step™ Ultra TMB-ELISA Substrate Solution (Thermo Fisher Scientific, San Jose, CA, US), mean absorbances in duplicates were read at 450nm and ratio of HAA/PNA was calculated for each sample in order to measure changes of glycosylation ...