Labshake search
Citations for Thermo Fisher :
4151 - 4200 of 10000+ citations for Aldosterone Chemiluminescent ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Cells were pelleted (400xg, 10 min) and supernatants subjected to ELISA analysis for IL-17a (Thermo Fisher, UK).
-
bioRxiv - Immunology 2022Quote: ... Human IFNg and IL-13 cytokine secretion was measured by ELISA using eBioscience Ready-SET-Go! (now ThermoFisher) ELISA kits according to the manufacturer’s protocol.
-
bioRxiv - Immunology 2022Quote: ... CRP and IL-6 were measured in UCB plasma using a high-sensitivity ELISA (Life Technologies, Carlsbad CA) per the manufacturer’s instructions.
-
bioRxiv - Immunology 2022Quote: ... and the assay was developed with 1-Step™ Ultra TMB-ELISA Substrate Solution (Thermo Fisher, Cat#34029) and blocked with 2N H2S04 solution before reading ...
-
bioRxiv - Immunology 2022Quote: ... 200 ng/ml) and medium was collected for analysis of the amount of secreted TNFα by ELISA (Invitrogen).
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The concentration of Aß40 and Aß42 in the culture medium was quantified by ELISA (Thermo Scientific, Waltham, MA). Briefly ...
-
bioRxiv - Microbiology 2022Quote: ... supernatants were collected for cytokine analysis by ELISA (IL-2 BD-OptEIA™; IL-17A, IFN-γ ThermoFisher) following manufacturer’s instructions.
-
bioRxiv - Immunology 2022Quote: ... supernatants were collected and cytokines quantified by ELISA according to manufacturers’ instructions (R&D Systems, Biolegend of Invitrogen), except antibody and sample volumes were halved.
-
bioRxiv - Neuroscience 2024Quote: ... The concentrations of human α-synuclein were measured using a human α-syn-specific ELISA (ThermoFisher Scientific #KHB0061) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... the substrate of the peroxidase (100µL, 3,3’,5,5’-tetramentylbenzidine solution; 1-StepTM Ultra TMB-ELISA, 34029, Thermo Scientific) was added in each well for 10 to 25 minutes at RT and in darkness ...
-
bioRxiv - Physiology 2023Quote: ... IL-6 and FFA content were measured by ELISA (IL-1β, Biolegend, 432604; IL-6, Invitrogen, BMS603-2) or a FFA fluorometric kit (Cayman Chemical ...
-
bioRxiv - Cancer Biology 2023Quote: ... 50 μg protein per sample was used to perform mouse Granzyme B Platinum ELISA (Thermo Fisher Scientific #BMS6029) and the protocol was followed as per the product manual.
-
bioRxiv - Cell Biology 2023Quote: ... Concentrations of IL33 and periostin in culture supernatants were measured by ELISA according to the manufacturer’s instructions (Invitrogen, cat # ...
-
bioRxiv - Cell Biology 2023Quote: ... antibody concentration (ng/ml) in collected media was determined with Total Mouse IgG enzyme-linked immunoassay (ELISA, Invitrogen) and extrapolated from generated standard curves ...
-
bioRxiv - Plant Biology 2020Quote: ... The amplicons were checked by electrophoresis and 25 µl of each pooled PCR product were purified and normalized using SequalPrep Normalization Plate Kit (Invitrogen GmbH, Karlsruhe, Germany). We then pooled the samples and the mock community and proceeded for a single library preparation ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Sequencing reactions were carried out on 96-well plates using BigDye Terminator v3.1 Cycle Sequencing Ready Reaction Kit (Applied Biosystems, foster City, CA) for 30 cycles ...
-
bioRxiv - Biochemistry 2020Quote: Total RNA was extracted from 10-day old seedlings grown on ½ MS plates under long-day conditions using PureLink RNA Mini Kit (Thermo Fisher Scientific, 12183025). One microgram of total RNA was reverse transcribed into cDNA with Protoscript II (New England Biolabs ...
-
bioRxiv - Microbiology 2021Quote: ... as described in Caporaso et al.[24] PCR products were cleaned and normalized using the SequalPrepTM Normalization Plate Kit (Cat. No. A1051001, ThermoFisher, Waltham, MA, USA) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA was produced from mRNA from cells lysed directly in the culture plate using the TaqMan® Gene Expression Cells-to-CT™ Kit (ThermoFisher Scientific). qRT-PCR was then carried out using the corresponding TaqMan™ Gene Expression Assay Kit that include exonspanning probes for genes of interest (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... The plates were incubated at 37°C for 24 hr and stained with a Filmtracer LIVE/DEAD Biofilm Viability Kit (Invitrogen, Carlsbad, CA, USA) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... skin homogenate or 100 µl of insect homogenate was extracted in a 96-well plate with the MagMAX™ CORE Nucleic Acid Purification Kit (Applied Biosystems, A32700) using protocol A in a KingFisher™ Flex Magnetic Particle Processor (Applied Biosystems ...
-
bioRxiv - Genomics 2020Quote: 10 μL of PCR product for each sample was normalized using a SequalPrep 96-well Normalization Plate Kit (Thermo Fisher Scientific, Waltham, MA). Samples were eluted in 20 μL of elution buffer and 10 μL of each sample was pooled and concentrated to 20 μL using 0.7x AMPureXP beads (Beckman Coulter ...
-
bioRxiv - Immunology 2022Quote: DNA in 100 µl of undiluted cell-free BALF (first wash) was quantified in DNase-free 96-well plates (TPP®) using Quant-iTTM Pico GreenTM dsDNA Assay Kit (Thermo Fisher Scientific) following manufacturers’ instructions.
-
bioRxiv - Zoology 2019Quote: Ten microliters of PCR amplicon was purified and normalized for concentration prior to library preparation using SequalPrep Normalization Plate Kit (Thermo Fisher Scientific, USA). DNA libraries were prepared using the NEBNext Ultra DNA Library Prep Kit for Illumina (New England BioLabs ...
-
bioRxiv - Genomics 2022Quote: ... and split half for maintenance in a well of a 96-well plate and half used for genotyping using the Phire Animal Tissue Direct PCR Kit (Thermo Fisher Scientific, F140WH) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... 10 µL of each concentration was transferred into a U-shaped 96-well plate and incubated with 100 µL QuantaBlu™ Fluorogenic Peroxidase Substrate Kit (Thermo Scientific™) for 40 minutes along with the sEV samples to be detected on O-NEXOS ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... for final quality assurance the CFFT Lab subjected all its plasmids from the daughter plate to next generation sequencing (NGS): DNA from plasmid constructs was quantitated using Qubit dsDNA HS Assay Kit (Q33230, Thermo Fisher Scientific, USA) as per manufacturer instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 9 µL of the dPCR reaction mix was added to each well of a QuantStudio Absolute Q MAP16 Plate Kit (PN A52865, ThermoFisher Scientific, Waltham, MA). Next ...
-
bioRxiv - Neuroscience 2024Quote: ... Raw cytokine values per well were normalized over nuclei number per well based on fluorescent staining of the fixed iAstrocytes in the plate or over protein content per well determined by Pierce™ BCA protein assay kit (Thermo Scientific, 23225). Pierce™ BCA protein assay was performed in a microplate as described in the user guide provided by Thermo Scientific.
-
bioRxiv - Cell Biology 2024Quote: ... was used to measure collagen in lung lobes following kit instructions and optical density was measured using a Varioskan LUX plate reader (Thermo Fisher Scientific, VL0000D0).
-
bioRxiv - Immunology 2020Quote: ... BRET signal was read after 5 min of coelenterazine-h (5 μM, Invitrogen) addition ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 52h after plating 5 µM 5-ethynyl-2′-deoxyuridine (EdU, Life Technologies) was added for 20 h ...
-
bioRxiv - Cell Biology 2022Quote: ... Then 5 μg/ml Hoechst 33342 and 5 µM CellRox Deep Red (Invitrogen) and/or MitoSox Red (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: - Falcon round-bottom polystyrene tubes 5 mL (Cat# 14-959-5, Fisher Scientific)
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... #2: 5’-gatcccGATTACTCGGCCATGATCAAAgcttcctgtcacTTTGATCATGGCCGAGTAATCttt ttta-3’ and 5’-agcttaaaaaaGATTACTCGGCCATGATCAAAgtgacaggaagcTTTGATCATGGCCGAGTAATgg-3’ were purchased from Invitrogen. The DNA oligo pairs were annealed and inserted into pEntryCla12-chickU6 shuttle vector using BamHI/HindIII site.
-
bioRxiv - Cell Biology 2020Quote: ... Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen; HSS118307 (Sigma); optineurin siRNA (Invitrogen 4392420) ...
-
bioRxiv - Microbiology 2023Quote: ... 5-fluorocytosine (100 mg/kg/d; diluted in sterile saline; 5-FC; ThermoFisher) was used in combination with PEA (0.5 mg/kg/d ...
-
bioRxiv - Immunology 2023Quote: ... 5x10-5 M 2-mercaptoethanol (2-ME) and 5 mM HEPES (all Invitrogen).
-
bioRxiv - Molecular Biology 2024Quote: ... supplemented with 5% fetal calf serum and 5% newborn calf serum (both GIBCO) and antibiotics (#A5955 ...
-
bioRxiv - Molecular Biology 2024Quote: ... supplemented with 5% fetal calf serum and 5% newborn calf serum (both GIBCO), and antibiotics (#A5955 ...
-
bioRxiv - Microbiology 2024Quote: ... 0.6 μL of 5 μM TaqMan probe (5’-FAM-CAAGAGGTGGACGGCC-MGB) (ThermoFisher Scientific) and 0.1 μL of nuclease free water ...
-
bioRxiv - Microbiology 2022Quote: ... The F gene was PCR amplified using primers RSV F 5’ (5’GCAAGGATTCCTTCGTGAC3’) and RSV F 3’ (5’CACACCACGCCAGTAG3’) and Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific). Sanger sequencing was performed by Elim Biosciences.
-
bioRxiv - Molecular Biology 2022Quote: ... pLV-mCherry at ratio 1:1:1 (i.e. 5:5:5 μg) using Lipofectamin™ 3000 transfection reagent (Thermo-Fisher Scientific, #L3000015). Pseudoviruses harvested from the supernatant at 48 h 72h post-transfection were filtered (0.44 μm ...
-
bioRxiv - Clinical Trials 2019Quote: ... (Bruner and Siliciano, 2018), env (Forward: 5’-AGTGGTGCAGAGAGAAAAAAGAGC-3’, Reverse: 5’-GTCTGGCCTGTACCGTCAGC-3’, Probe: 5’/VIC/CCTTGGGTTCTTGGGA/3’/MGB) (Thermo Fisher Scientific) (Bruner et al. ...
-
bioRxiv - Clinical Trials 2019Quote: ... (Palmer et al., 2003) and pol (Forward: 5’-GCACTTTAAATTTTCCCATTAGTCCTA-3’, Reverse: 5’-CAAATTTCTACTAATGCTTTTATTTTTTC-3’, Probe: 5’/NED/AAGCCAGGAATGGATGGCC/3’/MGB) (Thermo Fisher Scientific) (Schmid et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgKLF5 pool (5’- GUGCGCUCGCGGUUCUCUCG-3’; 5’- AGGACGUUGGCGUUUACGUG-3’; 5’- GCGUCAAGUGUCAGUAGUCG-3’) was transfected per well using Lipofectamine™ RNAiMAX (Thermofisher, 13778150). Media was changed after 72 hours for longer treatments.
-
bioRxiv - Immunology 2022Quote: ... custom primers and probes designed to amplify and label the Chlamydia 16S gene were used (forward: 5’-GGAGGCTGCAGTCGAGAATCT-3’; reverse: 5’-TTACAACCCTAGAGCCTTCATCACA-3’; probe 5’-6FAM-TCGTCAGACTTCCGTCCATTGCGA-TAM-3’; Fisher Scientific/Eurofins).
-
bioRxiv - Pathology 2023Quote: ... one lung section 5×5×5 mm in size was finely cut and stored at -20°C in RNAlater (Thermo Scientific, US). We mechanically disrupted the tissue from RNAlater using a MediMachine (BD Biosciences ...
-
bioRxiv - Biochemistry 2024Quote: ... the RNA was subjected to 5’ adapter ligation with a 5’ chimeric DNA-RNA adapter (5’aminolinker-GTTCAGAGTTCTACAGTCCGACGATCrNrNrNrN) using RNA ligase (EL0021, Thermo Fisher Scientific) at 37°C for 1 hour ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).