Labshake search
Citations for Thermo Fisher :
3951 - 4000 of 10000+ citations for Aldosterone Chemiluminescent ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: ... The PepMap100 C18 (5 μm 0.3 x 5 mm, Thermo Fisher Scientific) and the ACQUITY BEH C18 (1.7 µm 1.0 × 100 mm ...
-
bioRxiv - Cell Biology 2024Quote: ... the oligonucleotides 5’-CCTGTGCAGCCGTCCATAGGGCCTGTCAGTCAGTGGCCAAAACAGGCCTAT GAGGACGGCTGCAC-3’ and 5’-TGCTGTGCAGCCGTCCTCATAGGCCTGTTTTGGCCACTGACTGACAGGCCTATGGACGGCTGCA-3’ (#Mmi520981, Invitrogen) were used ...
-
bioRxiv - Molecular Biology 2024Quote: ... or 5 μl/IP anti-GFP (A-11122, ThermoFisher, 5 ul/IP), for 3 hours at 4°C ...
-
bioRxiv - Genetics 2021Quote: ... designing primers to full length MC1R and cloning PCR product of cDNA and genomic from NK cells from 5 heterozygous individuals heterozygous using TA Cloning kit (Thermofisher). In addition ...
-
bioRxiv - Genetics 2021Quote: ... cDNA was synthetized from 5 μg of RNA with the Maxima H Minus First Strand cDNA Synthesis Kit (Thermo Scientific) and oligo (dT)18 primer ...
-
bioRxiv - Immunology 2022Quote: Annealed oligonucleotides containing the sequence of the HCV 5’ppp poly-U/UC region (34) were in vitro transcribed using the MEGAshortscript T7 transcription kit (Ambion) followed by ethanol precipitation ...
-
bioRxiv - Molecular Biology 2021Quote: J1 mES cells were grown on glass coverslips and incubated for 1h (37°C, 5% CO2) with EU from the Click-iT RNA Alexa Fluor 594 imaging kit (C10330, Invitrogen). Cells were fixed with 3,7% formaldehyde in PBS 1× for 15min at room temperature and permeabilized with 0.5% Triton X-100 in PBS 1× for 15min at room temperature ...
-
bioRxiv - Microbiology 2019Quote: ... double-stranded cDNA was synthesized from 5 μg of total RNA using the Superscript double-stranded cDNA synthesis kit (Invitrogen). Following phenol/chloroform extraction and ethanol precipitation ...
-
bioRxiv - Developmental Biology 2019Quote: ... and sequenced with the primers indicated in Extended Data Table 5 using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) on a 3130xl Genetic Analyzer (Applied Biosystems) ...
-
bioRxiv - Immunology 2019Quote: ... 5’ ATCCGCACCGACTCGGT 3’ and Rv: 5’ GCGTAATACGACTCACTATAG 3’ and purified using the Quick gel extraction and PCR purification combo kit (00505495, ThermoFisher). The PCR products were confirmed by an agarose gel electrophoresis and by Sanger sequencing (Base Clear ...
-
bioRxiv - Molecular Biology 2019Quote: Three specific 5’ RACE primers and two 3’ RACE primers were designed according to the Race kit instructions (Invitrogen & Clontech) (Table S1) ...
-
bioRxiv - Microbiology 2019Quote: ... burnetii total RNA extracted from LCVs (3dpi) infecting Vero (carA and metK) or THP-1 (cvpD) cells using a 5’ RACE System kit (Invitrogen) according to manufacturer protocols and with gene-specific primers (see S9 Fig) ...
-
bioRxiv - Immunology 2019Quote: Annealed oligonucleotides containing the sequence of the HCV 5’ppp poly-U/UC region (Table 1) (20) were in vitro transcribed using the Megashortscript T7 transcription kit (Ambion) followed by ethanol precipitation ...
-
bioRxiv - Microbiology 2021Quote: ... The samples were centrifuged for 5 min at 10,000 xg and the protein content of the supernatant was determined using a BCAassay kit (Thermo Scientific). The c-di-AMP concentrations are presented as ng c-di-AMP/mg C ...
-
bioRxiv - Plant Biology 2021Quote: ... the putative target of miR775 was validated by modified 5′RLM-RACE using First Choice RLM-RACE Kit (Ambion,USA) following manufacturer's instructions with minor modifications ...
-
bioRxiv - Microbiology 2021Quote: ... using a HA-specific primer (5’-GTCCTTGCGACTG-3’) and a RevertAid first-strand cDNA synthesis kit (Invitrogen, Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... using a HA-specific primer (5’-GTCCTTGCGACTG-3’) and a RevertAid first-strand cDNA synthesis kit (Invitrogen, Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: 1 μg total RNA from healthy and OS samples was used for 5’ and 3’ RACE reactions with the FirstChoice RLM-RACE kit (Ambion) according to manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... Total RNA was isolated from sorted 2-3×10^5 CD34+ cells using the mirVANA miRNA isolation kit (Thermo Fisher) and subsequently processed using the Small RNA Library Prep kit (Norgen Biotek) ...
-
bioRxiv - Cell Biology 2020Quote: ... 5-ethynyl-2-deoxyuridine (EdU) labelling performed with Invitrogen Click-iT EdU Alexa Fluor 594 Imaging Kit (Life Technologies, C10339).
-
bioRxiv - Biophysics 2022Quote: ... Matthias Mack (Signoret et al., 2000)MC-5 was fluorescently labeled using DyLight 650 NHS ester coupling kit (Thermo Fisher) with a dye:protein coupling ratio of 1.57:1.
-
bioRxiv - Neuroscience 2022Quote: Using a subcloned and sequenced PCR fragment (162 bp – Table S1) of the mouse 5-HT2AR cDNA (Zero Blunt TOPO PCR Cloning kit, Invitrogen), high specific-activity RNA probes were produced from a linearized plasmid (HindIII ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5’L1-3’L2 orientation were inserted via recombination into a pCS2+ Gateway-converted vector (Custom vector conversion kit; Invitrogen). Details of the Gateway plasmid are available upon request ...
-
bioRxiv - Cancer Biology 2022Quote: ... we performed 5-ethynyl-2′-deoxyuridine (EdU) staining using the Click-iT EdU Alexa Fluor 647 imaging kit (C10340, Invitrogen). Four-color image acquisition of three replicates per condition was performed on an SP8 confocal microscope (Leica) ...
-
bioRxiv - Neuroscience 2020Quote: ... 5-ethynyl-2’-deoxyuridine (EdU) staining was performed using Click-iT EdU Alexa Fluor 488 Imaging Kit (Thermo Fisher Scientific) following the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... 5 mM MgCl2 and 0.5 mM MnCl2) and quantified by using Pierce™ BCA Protein Assay Kit (23227, Thermo scientific). In the case of protease digestions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Untranslated regions were cloned using synthetic DNA (Integrated DNA Technologies) or by isolation using 5′ RACE (RLM-RACE kit, Invitrogen). Template was PCR amplified using Phusion polymerase from the plasmids using the following primers ...
-
bioRxiv - Molecular Biology 2020Quote: ... DIV14 neurons were incubated with 200 µM 5-EU (Click-iT™ Nascent RNA Capture Kit, Invitrogen, cat. no. C10365) for 0 (input and “unlab”) ...
-
bioRxiv - Microbiology 2020Quote: ... Purified total bacterial RNA from each of the 5 tubes was pooled and genomic DNA removed using the TURBO DNA-free kit (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: Total RNA was isolated from groups of 5 HIOs per replicate with a total of 4 replicates per infection condition using the mirVana miRNA Isolation Kit (ThermoFisher). Cytosolic and mitochondrial ribosomal RNAs were removed from samples using the Ribo-Zero Gold Kit according to manufacturer’s protocol (Illumina) ...
-
bioRxiv - Microbiology 2021Quote: ... target cells were labelled with 5 µM of carboxyfluorescein succinimidyl ester (CFSE) from a CFSE cell proliferation kit (Invitrogen, C34554) for 5 min at room temperature ...
-
bioRxiv - Immunology 2022Quote: ... Dead cells were excluded by staining for 5 min on ice with LIVE/DEAD Fixable Blue Dead Cell Stain Kit (Invitrogen) before fixation ...
-
bioRxiv - Molecular Biology 2019Quote: ... At least 5 µg of mRNA was purified from total RNA using the Poly(A)Purist MAG kit (AM1922, Ambion). mRNAs were fragmented for 3 minutes at 70 °C using a Zinc-based alkaline fragmentation reagent (AM8740 ...
-
bioRxiv - Neuroscience 2020Quote: ... Briefly, cDNA was derived from 5 week-old C57BL/6J retina (Jackson, 000664) following RNA extraction (RNAqueous Kit, Ambion, AM1912) and reverse transcription with Superscript III (ThermoFisher ...
-
bioRxiv - Cancer Biology 2019Quote: ... Click-iT Alexa Fluor 488 EdU (5-ethynyl-2’-deoxyuridine) imaging kit and Lipofectamine RNAiMAX was purchased from Life Technologies. Foetal Bovine Serum (FBS ...
-
bioRxiv - Microbiology 2020Quote: ... one or two guanines were added to the 5’ end of the guide sequence within the primer to ensure the format “5’-GG(N18-20)-3’” in order to facilitate in vitro transcription with MEGAscript T7 in vitro transcription kit (Ambion). Transcribed sgRNAs were purified with MEGAclear kit (Invitrogen) ...
-
bioRxiv - Bioengineering 2020Quote: ... the cells were stained for 5 minutes at room temperature with LIVE/DEAD Fixable Violet Dead Stain Kit (ThermoFisher L34864). Subsequently ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were pre-treated with 5-ethynyl uridine (EU) for 30 min prior to nuclei fractionation using Sigma kit (#NUC101) followed by Invitrogen Click-iT™ Nascent RNA Capture Kit protocol for nascent transcript extraction (#C10365) ...
-
bioRxiv - Microbiology 2019Quote: ... The suspension was centrifuged at 12,000 g for 5 min and the protein supernatant was quantified using the BCA protein assay kit (ThermoFisher Scientific) following manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... The cells were stained for 5 minutes at room temperature with LIVE/DEAD Fixable Violet Dead Stain Kit (ThermoFisher L34864). Subsequently ...
-
bioRxiv - Genomics 2021Quote: RNA from individual E10.5 hearts (N=3 or 5 per genotype) was isolated using the RNAqueous-Micro Total RNA Isolation Kit following manufacturer recommended protocols (Invitrogen). cDNA synthesis was performed using random hexamers and SuperScript IV reverse transcriptase (Invitrogen) ...
-
bioRxiv - Developmental Biology 2021Quote: ... We injected pregnant mice intraperitoneally with 100 μL of 5-ethynyl-2’-deoxyuridine (EdU, Click-iT EdU Alexa Fluor 647 Imaging Kit, Invitrogen) at 1mg/mL ...
-
bioRxiv - Genomics 2021Quote: ... RNA purity and concentration were determined and cDNA was synthesized using 5 μg RNA and the MMLV reverse transcription kit (Invitrogen). PCR was performed using 20 μl reaction volume contained 1 × PCR Buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... Untranslated regions were cloned using synthetic DNA (Integrated DNA Technologies) or by isolation using 5′ RACE (RLM-RACE kit, Invitrogen). Template was PCR amplified using Phusion polymerase from the plasmids using the following primers ...
-
bioRxiv - Microbiology 2020Quote: Total RNA was isolated from groups of 5 HIOs per replicate with a total of 4 replicates per condition using the mirVana miRNA Isolation Kit (ThermoFisher). Cytosolic and mitochondrial ribosomal RNA was removed from samples using the Ribo-Zero Gold Kit according to manufacturer’s instructions (Illumina) ...
-
bioRxiv - Plant Biology 2020Quote: ... radiolabeled probes were prepared from linearized plasmid templates (SpeI or NcoI) having 5’ overhangs from either T7 or SP6 RNA polymerase using the MAXIscript Kit (Ambion) to produce the HvCESA1 antisense-targeting (466nt ...
-
bioRxiv - Genetics 2020Quote: ... Real-time quantitative PCR were performed on 1ml of diluted RT reactions (1/5) using SYBR Green kit (Life Technologies) on a One Step Plus thermocycler (Thermo Fisher) ...
-
bioRxiv - Microbiology 2022Quote: ... Oligonucleotide probes from IDT hybridizing to SdsR or 5S rRNA were end-labelled using KinaseMax 5′ end-labelling kit (Ambion). Blots were hybridized overnight with 32P-5′ end-labelled probes at 42°C ...
-
bioRxiv - Developmental Biology 2022Quote: 5-ethynyl-2-deoxyuridine (EdU) pulse labeling was performed with the Click-IT EdU imaging kit (Life Technologies; Cat#:C10340) as described in (Perillo et al. ...
-
Allelic diversity uncovers protein domains contributing to the emergence of antimicrobial resistancebioRxiv - Microbiology 2022Quote: ... Samples were diluted 1:5 in sample loading buffer and quantified using the Pierce BCA Protein Assay Kit (Thermo Scientific). Lysates were normalized to 100μg/mL in 1X Bolt™ LDS Sample Buffer (Invitrogen) ...