Labshake search
Citations for Thermo Fisher :
4101 - 4150 of 10000+ citations for 6H 1 3 Dioxolo 4 5 g 1 benzopyran 6 one 7 8 dihydro since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... were made up in HPLC grade H2O (1 mL) immediately before injection onto a ProPac PA-1 analytical column (4 × 250 mm, ThermoFisher Scientific, UK), pre-equilibrated in HPLC grade H2O at a flow rate of 1 mL.min-1 ...
-
bioRxiv - Neuroscience 2020Quote: ... OFC sections were reacted with the primary antibody for rabbit met-enkephalin (1:400, Abeam ab22620) for 24h at 4°C and Alexa-fluor 488 goat anti rabbit secondary antibody (Invitrogen, 1:400) for 24 hours at 4°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... the samples were washed with PBS and incubated in the dark for 1 h at 4 °C with secondary antibody (Alexa Fluor-568-conjugated anti-mouse antibody, 1:750, Thermo Fisher Scientific). Finally ...
-
bioRxiv - Molecular Biology 2022Quote: ... at 30 V for 1 hour followed by100 V for a further hour at 4°C in 1× NuPAGE Transfer Buffer (Thermo Fisher Scientific) supplemented with 0.1 g/l of SDS (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... (alone or in combination) in IF washing buffer overnight at 4°C: anti-ZO-1 rabbit polyclonal (1:200) (Thermo Fisher Scientific), anti-E-cadherin rabbit monoclonal (1:200 ...
-
bioRxiv - Microbiology 2021Quote: ... and the SARS-CoV-2 isolate Wuhan-Hu-1 (GenBank accession #: MN908947) at a 4:1 ratio by lipofectamine 3000 (Thermo Fisher Scientific). After 48 to 72 hours ...
-
bioRxiv - Cell Biology 2019Quote: ... Collagen/laminin coating was accomplished by overnight incubation of the plates rocking at 4°C with a 1:1 mixture of laminin (10 µg/ml ThermoFisher 23017-015) and collagen (10 µg/ml Sigma C8919 ...
-
bioRxiv - Microbiology 2022Quote: ... the Transwell inserts were incubated with one of the following primary Abs in IF wash buffer overnight at 4°C: anti-ZO-1 rabbit polyclonal (1:200) (40-2200, Thermo Fisher Scientific), anti-E-cadherin rabbit monoclonal (1:200 ...
-
bioRxiv - Neuroscience 2023Quote: ... concentration 1:100) for 24 h at 4°C followed by labeling with goat anti-rabbit Alexa fluor 488 (A11034, Invitrogen, 1:1000) as a secondary antibody for 3 h at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... 10% Donkey Serum, 1% Triton-100, 1h) followed by primary (overnight, 4°C) and secondary antibodies (1-2h, Jackson ImmunoResearch or ThermoFisher Scientific) incubation ...
-
bioRxiv - Cell Biology 2023Quote: ... and 20% sucrose-PBS and then incubated overnight at 4°C in a 1:1 solution of 20% sucrose and OCT compound (Fisher Scientific: #23730571). The next day ...
-
bioRxiv - Developmental Biology 2023Quote: ... were mechanically lysed in [100 μl/sample + 10 μl extra] lysis buffer (100 mM NaCl, 50 mM Tris, 4 mM EDTA, 1% NP40, 1 μl/ml SUPERaseIN (Thermo Fisher #AM2694), and 1x cOmplete Protease Inhibitor (Roche #11836153001) ...
-
bioRxiv - Genomics 2023Quote: ... 2.0 mM 2-mercaptoethanol and 0.1 mg/mL-1 bovine serum albumin) and then stopped by adding 4× LDS sample buffer (∼3.3μL) (Thermo Fisher Scientific, no. NP0007) to a final concentration of 1× (final volume ∼13.3μL) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Staining was performed at 1:200 for 30 minutes prior to fixation overnight in 1% phosphate buffered formalin (Fisher Scientific, SF100-4). Note ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were passaged 1:4 into new six-well plates with complete DMEM containing 2 μg mL-1 puromycin (Thermo Fisher Scientific). After selection for two weeks ...
-
bioRxiv - Immunology 2023Quote: NK cells were activated by co-culturing NK cells with irradiated K562 cells expressing membrane bound interleukin-21 and 4-1BBL at 1:1 ratio in RPMI (Gibco, Thermo Fisher) supplemented with 10% FCS (Sigma-Aldrich) ...
-
bioRxiv - Biochemistry 2024Quote: ... Primary antibodies were detected using secondary antibodies (diluted 1:500-1:1000 in PBS/4% BSA) conjugated to Alexa Fluor 568 or 647 (Thermo Fisher Scientific). Cells were counterstained with DAPI and kept in PBS until images were taken with the LSM780 microscope.
-
bioRxiv - Biochemistry 2019Quote: ... membranes were probed for 1 hr at RT with Horseradish peroxidase (HRP) - conjugated secondary antibodies were used to detect mouse (Thermo Fisher Scientific; G-21040, 1/2500) and rabbit IgG (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2019Quote: 40 ng of RNA was amended with 8 μl of a 10,000X dilution of External RNA Control Consortium47 (ERCC) Spike-In Mix 1 (Ambion). The ERCC mix consists of 92 transcripts ranging from 250 to 2,000 nt in length with a large dynamic fold range ...
-
bioRxiv - Systems Biology 2021Quote: ... 75,000 cells were seeded into collagen-1 (Cultrex #3442-050-01) coated 8-well plates (Thermo Fisher Scientific 267062) in GM ...
-
bioRxiv - Cell Biology 2021Quote: ... Beads were washed extensively (8 times) in extraction buffer before being resuspended in 1 ml of Trizol (Invitrogen, 15596026) and vortexed vigorously ...
-
bioRxiv - Microbiology 2020Quote: ... BS-C-1 cells were seeded into Nunc™ 8-well Lab-Tek II chambered coverglass slides (Thermo Scientific) to obtain 50 to 70% confluence on the day of tracking ...
-
bioRxiv - Neuroscience 2021Quote: A solution of 2 μM of Calcein-AM and 8 μM of ethidium homodimer-1 (both from L3224, ThermoFisher) in DPBS (14190-144 ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 × 104 293T-GRET/-PalmGRET cells were seeded per well into a glass-bottom 8-well chamber (#1.5, Nunc™ Lab-Tek™ II Chamber Slide™ System ...
-
bioRxiv - Molecular Biology 2020Quote: BMDMs were seeded at 1×105 cells/well in 8 wells Nunc Lab-Tek II Chamber Slide (Thermo Scientific). The next day ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were trypsinized and plated onto coverslips (1:2 split) or Nunc 8 well chamber slides (Thermo Fisher # 155409PK) (20-40k cells per well).
-
bioRxiv - Developmental Biology 2024Quote: ... Medium was replaced daily from 8 hpf and supplemented with 0.2 mM 1-phenyl-2-thiourea (10107703, Acros Organics) to inhibit melanogenesis ...
-
bioRxiv - Bioengineering 2023Quote: ... the cells were cultivated for 8 passages in expansion medium containing DMEM (gibco) supplemented with 1 % antibiotic– antimycotic (Invitrogen) and 10 % FBS (South Afrika FBS ...
-
bioRxiv - Zoology 2024Quote: ... injected embryos were frequently cultured through stage 8 in HL saline containing roughly 1% commercial penicillin-streptomycin solution (Gibco).
-
bioRxiv - Molecular Biology 2020Quote: One hundred micrograms of mitochondrial proteins were separated on 4-16% (w/v) polyacrylamide Native PAGE gels (Invitrogen) and then either transferred to PVDF membranes or subjected to in-gel activity staining as in previously described in (25) ...
-
bioRxiv - Microbiology 2022Quote: ... A total of 4 μg of RNA was treated with one unit of DNase I Amplification Grade (Invitrogen) to remove potential contamination with genomic DNA ...
-
bioRxiv - Microbiology 2022Quote: ... Eluted protein complexes were separated by one-dimensional 4-12% NuPage Novex Bis-Tris Gel (Invitrogen, Cat. NP0321BOX) and stained using the Colloidal Blue Staining Kit (Invitrogen ...
-
bioRxiv - Immunology 2019Quote: ... 5’ ATCCGCACCGACTCGGT 3’ and Rv: 5’ GCGTAATACGACTCACTATAG 3’ and purified using the Quick gel extraction and PCR purification combo kit (00505495, ThermoFisher). The PCR products were confirmed by an agarose gel electrophoresis and by Sanger sequencing (Base Clear ...
-
bioRxiv - Cell Biology 2021Quote: ... The Stim coding sequence was cloned by PCR using primers 5’-CAC CAT GCG AAA GAA TAC CAT TTG GAA C-3’ and 5’-TTC CGT GGC AAG CAG CGA AAA GTT C-3’ and ligated into pENTR/D-TOPO (Invitrogen). Site-directed mutagenesis (Stratagene QuikChange XL ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-AACGGGAAGCTTGTCATCAA-3’) (Berg et al., 2019) or telomeres (Telo, 5’-UUAGGGUUAGGGUUAGGGUU-3’) (McCaffrey et al., 2017) were transfected using RNAiMAX (Invitrogen). In brief ...
-
bioRxiv - Synthetic Biology 2024Quote: ... the full volume of media in each well was pipetted gently 4-5 times and added to 1 mL of FACS buffer containing 3 uM DAPI (PBS pH 7.4, 2–5 mM EDTA, 0.1% BSA, 3 uM DAPI (Thermo Scientific #62247)) ...
-
bioRxiv - Biochemistry 2023Quote: ... coverslips were silanized in a 3:5:100 mixture of (3-Aminopropyl)triethoxysilane (APTES) (Fisher Scientific UK, Cat. No. 10677502), acetic acid ...
-
bioRxiv - Cell Biology 2023Quote: ... with 5’-GGTTTGGGGCTGGGCAT-3’ and 5’-AGGTGCAGCAGCAGTACG-3’ primers (Guillen-Samander et al., 2022) and cloning with the TOPO TA Cloning Kit (Invitrogen).
-
bioRxiv - Bioengineering 2019Quote: ... via covalent attachment to COOH groups on the particles via standard EDC chemistry using 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (Thermo Fisher Scientific, MA) and N-hydroxysulfosuccinimide sodium salt (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... Brains were washed in 3 times in 3% PBST (10 min) and incubated in goat anti-chicken Alexa Fluor 488 (Invitrogen, A11039, 1:1000) in blocking buffer at room temperature for 2hrs ...
-
bioRxiv - Developmental Biology 2024Quote: ... Maturation of released oocytes was induced by incubating for 1h at 16°C in 3 μM 1-Methyladenine (Fisher Scientific, 5142-22-3).
-
bioRxiv - Molecular Biology 2023Quote: ... Naïve hESCs were routinely passaged as single cells every 3 days at a ratio of 1:3 using TrypLE™ Express (1X) (Gibco, Thermo Fisher Scientific) and plated in fresh media supplemented with 10 μM of Y-27632 (Stemcell Technologies).
-
bioRxiv - Microbiology 2024Quote: ... and Reverse primer: 3’-GGGCGGTAGTCGTAATTGTT-5’ were subjected to qRT-PCR for amplifying Amastin in QuantStudio 5 (Applied Biosystems) in triplicates ...
-
bioRxiv - Genetics 2021Quote: ... We then amplified and eif-3.G cDNA using primers for the SL1 trans-splice leader (YJ74) and eif-3.G isoform A 3′UTR (YJ11560) and Phusion polymerase (Thermo Fisher Scientific, San Diego, CA). The cDNA clones in PCR8 vector were then used to generate tissue-specific expression constructs using Gateway™ cloning destination vectors (pCZGY1091 for Punc-17β ...
-
bioRxiv - Neuroscience 2022Quote: ... cells were loaded in microglia differentiation medium with 3 μM Fluo-4 AM and 3 μM Fura-Red AM (Molecular Probes) in the presence of Pluronic Acid F-127 (Molecular Probes ...
-
bioRxiv - Cell Biology 2022Quote: ... Blocks of tissue of ~3×3×4 cm (depth×width×height) were cut and prepared for sectioning using a Vibrating Blade Microtome (Thermo Fisher) at a thickness of 500μm ...
-
bioRxiv - Molecular Biology 2021Quote: ... Amplicons were purified with Agencourt AMPure XP beads in 0.7:1 ratio (beads to PCR reaction volume) and quantified with the Quant-iT™ High-Sensitivity dsDNA Assay Kit (Invitrogen). The amplicons were pooled together and sequenced on the Illumina HiSeq 2500 using HiSeq Rapid SBS Kit v2 (500 cycles ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cultures on feeder layers were performed on Mitomycin C-treated MEF as described above with passaging every 7 days using 1 mg/mL collagenase IV in DMEM/F12 (Life technologies) the feeder-free culture was performed on Geltrex™ (Life technologies ...
-
bioRxiv - Immunology 2019Quote: ... Then to stain the cells we used antibodies against LFA-1 (clone I21/7) and 4G10 with Alexa Fluor 568–conjugated phalloidin (Life Technologies) and DAPI ...
-
bioRxiv - Biochemistry 2019Quote: ... The valve then switches to engage the passive split such that a majority of LC effluent is diverted to waste prior to the third dimension PC. 13 RP-SAX-RP fractions were analyzed. Either an LTQ Velos (Figs. 1, 7) or Q-Exactive HF (Thermo Scientific) machine was used to acquire MS/MS spectra in data-dependent mode as described (Zhang et al. ...