Labshake search
Citations for Thermo Fisher :
4201 - 4250 of 10000+ citations for rno mir 134 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... The ligated product was amplified with a G-quadruplex-specific common primer (NGS-1290, 5’-GGAGGGGAGGGGAGAGGGG-3’) and an adaptor-specific common primer for 12 cycles with Phusion U (Thermo Fisher, #F555L). One-tenth of the amplification product was subjected to another round of amplification using Illumina P5/P7 primers ...
-
bioRxiv - Microbiology 2023Quote: ... and the SV40 early mRNA polyadenylation signal was amplified from pcDNA3.1(+)IRES GFP using the forward primer (CMVP F) containing EcoRI restriction site and the reverse primer (PolyA R) containing MluI (ThermoFisher Scientifc, USA) restriction site.
-
bioRxiv - Physiology 2023Quote: ... per manufacturer’s instructions and primers for the CaSeq1 gene of interest (IDT; San Jose, CA) along with primers for ERG1A (Invitrogen; Waltham, MA) and the GAPDH “housekeeping gene” (IDT ...
-
bioRxiv - Cancer Biology 2021Quote: 143B cells were plated into a 6-well plate and transfected with 100 nM of miR-34c mimic or negative miRIDIAN mimic using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... 20 ng of recombinant dual-luciferase plasmid and 6 pmol of either miR-29a mimic or scrambled control were mixed with 100 μL Opti-MEM containing 1 μL lipofectamine RNAiMax (Invitrogen, Cat.#13778) in 24-well plate wells ...
-
bioRxiv - Cell Biology 2021Quote: ... Calu-3 cells were seeded at 2.5×105/ml with 100 or 300 nM of hsa-miR-145-5p miRNA precursor (PM11480, Ambion, Thermo Fisher Scientific). After 72 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... qPCR was then performed in quadruplicates using a TaqMan Advanced microRNA assay for miR-379 (#478077_mir) and TaqMan Fast Advanced Master Mix (#4444557, Applied Biosystems, Austin, TX) according to the manufacturer’s instructions on a QuantStudio 7 Flex machine.
-
bioRxiv - Cell Biology 2021Quote: ... Transfection was performed by using Lipofectamine 2000 with 100 nM miRVANA miR-184 inhibitor (cat. 4464084, ID: MH10207-Invitrogen, Pittsburgh, PA, USA) respect to 100 nM negative miRNA control inhibitor (cat ...
-
bioRxiv - Bioengineering 2022Quote: ... PACE60 nanoparticles were formulated as described previously by double emulsion solvent evaporation using miR200b mimic (Invitrogen mirVana miRNA Mimic, hsa-miR-200b-3p, 5’-UAAUACUGCCUGGUAAUGAUGAC −3’, Cat# 4464066, Ambion, Austin, TX) or a negative control miR (Invitrogen mirVana miRNA Mimic ...
-
bioRxiv - Molecular Biology 2022Quote: ... The plasmid vectors (miR-34a, Flag-Cdt2 and 16E6) were transfected to the cells with turbofect™ (Thermo Fisher Scientific, Massachusetts, USA) the following day according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2020Quote: The miRNA expression vectors for Myo X and DCC were generated by the BLOCK-iT Lentiviral miR RNA Expression System (Invitrogen, Carlsbad, CA) according to the manufacturer’s instruction as previously described (Liu et al. ...
-
bioRxiv - Molecular Biology 2021Quote: 10 ng total RNA containing 5 pM ath-miR-159a spike-in was reverse-transcribed using Taqman Advanced miRNA cDNA synthesis kit (Applied Biosystems #A28007) and miRNAs were detected using specific probes for ath-miR159a (478411_mir) ...
-
bioRxiv - Cell Biology 2021Quote: ... with different combinations of CRTC1 siRNA and/or miR-184 inhibitor: 100 nM negative control miRNA inhibitor (cat. 4464076-Invitrogen, Pittsburgh, US) + 50 nM of CTR siRNA (cat ...
-
bioRxiv - Microbiology 2022Quote: The following miRNAs and negative controls were used: miR-TAR-3p (mirVana™ miRNA Mimic, mature sequence: UCUCUGGCUAACUAGGGAACCCA, Ambion Cat. No# 4464066), S1_TAR-3p (mirVana™ miRNA Mimic ...
-
bioRxiv - Molecular Biology 2023Quote: For the spectroscopic studies, a synthetic single-stranded desalted oligoribonucleotide (pre-miR-150-PQS, ST1) was purchased from Invitrogen (Carlsbad, CA, USA) resuspended in nuclease-free water and stored at -20°C until use ...
-
bioRxiv - Molecular Biology 2024Quote: ... IPed ALG-1 was incubated in a slicing buffer containing a radiolabelled miR-1 target RNA probe along with Yeast RNA (Ambion, catalogue #AM7120G) and RNAse inhibitor at 20°C for 90 minutes for slicing reaction ...
-
bioRxiv - Neuroscience 2024Quote: ... HEK293 cells were cotransfected with either Fos-WT or Fos-Mut vector and either miR-335-3p mimic or miRNA mimic negative control (mimic NC) using Lipofectamine 2000 (Invitrogen, USA; 11668019). Luciferase activity was determined at 48 h post-transfection using the Dual-Glo Luciferase Assay System (Promega ...
-
bioRxiv - Molecular Biology 2023Quote: ... Isolated RNA was subjected to cDNA synthesis and further for TaqMan assay specific for mature miR-9 (Applied Biosystems, Cat. No. 4427975).
-
bioRxiv - Molecular Biology 2023Quote: ... cells were lysed for RNA using TRIzol and expression of miR-146a and control RNAs was quantified by TaqMan Assay (Thermo Fisher Scientific).
-
bioRxiv - Bioengineering 2023Quote: Macrophages expressing the NGL NF-κB-luciferase reporter were either pre-treated with iEVs at a dose corresponding to an iEV donor and recipient cell ratio of 20:122 or transfected with a mirVana miRNA mimic mmu-miR-147-3p (Thermo Fisher Scientific) with Lipofectamine™ RNAiMAX Transfection Reagent (Life technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... miRNA (miRNA-NC or miR-150-3p) and Renilla luciferase (GeneChem, Shanghai, China) were transfected into HK-2 cells using Lipofectamine 3000 (Thermo Fisher Scientific) to determine whether FTH1 was a direct target of miR-150-3p ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were lysed for RNA using TRIzol and expression of miR-146a and control RNAs was quantified by TaqMan Assay (Thermo Fisher Scientific). Comparison of miR-146a induction between groups was performed using a Two-Way ANOVA with a Holms-Sidak post-hoc analysis ...
-
bioRxiv - Pathology 2024Quote: ... The pulp tissues were transfected with mirVana miRNA mimic miR-27a-5p or mirVana miRNA mimic Negative Control #1 (Thermo Fisher Scientific) using Lipofectamine RNAiMAX ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 mg/kg body weight miR-182-5p-mimic or negative control was injected via the tail vein using Invivofectamine® 3.0 (Invitrogen, Carlsbad, US). Mice were phenotypically characterized by NMR on days −1 and 7 and a glucose tolerance test after 6 h fasting on day 5 ...
-
bioRxiv - Bioengineering 2024Quote: ... mimic for osteogenic differentiation and miR-(140 + 21) mimic for chondrogenic differentiation before being seeded in Opti-MEM medium (Gibco, Carlsbad, CA) in 175 cm2 cell culture flasks for 24 h ...
-
bioRxiv - Immunology 2022Quote: ... Cells were then fixed and permeabilized with the Foxp3 Staining Buffer Set (Thermofisher), followed by intracellular staining of the cells with anti-CD3 BV605 (eBioscience ...
-
bioRxiv - Microbiology 2019Quote: ... and permeabilized using a Foxp3/Transcription Factor Staining Buffer Set (Themo Fisher Scientific). The permeabilized cells were then stained with anti-Foxp3 and anti-RORγt antibodies ...
-
bioRxiv - Genetics 2019Quote: ... using the eBioscience™ Foxp3 / Transcription Factor Staining Buffer Set (Thermo Fisher Scientific), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: External RNA Controls Consortium (ERCC) Spike-in (set 1) (Thermo Fisher Scientific, USA) was used as primary template24 ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were permeabilized using the Foxp3/Transcription Factor Staining Buffer Set (Thermo Fisher) following the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2021Quote: ... Following TMT six-plex Isobaric Label reagent set directions (ThermoFisher Scientific, Carlsbad, CA) each sample was labeled ...
-
bioRxiv - Genomics 2022Quote: ... A fluorometer set to High Sensitivity dsDNA 1X (Qubit™ 4 Fluorometer, Invitrogen) was used to quantify 1µl of the purified PCR product from library clean up one ...
-
bioRxiv - Immunology 2022Quote: ... Pierce™ Bovine Serum Albumin Standard Pre-Diluted Set kit (Thermo Fisher, 23208) was used to calculate the protein concentration of samples ...
-
bioRxiv - Immunology 2022Quote: ... cells were processed with the Transcription Factor Staining Buffer Set (Thermo Fisher Scientific) following the manufacturer protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... permeabilized and stained following Foxp3/Transcription Factor Staining buffer set (Thermo Fisher Scientific) manufacturer’s guidelines ...
-
bioRxiv - Molecular Biology 2019Quote: ... pEGFP-ANK or pEGFP-SET plasmids using Lipofectamine 2000 (11668019, Thermo Fisher Scientific). HDFs were maintained in DMEM supplemented with 10% FBS ...
-
bioRxiv - Molecular Biology 2021Quote: qPCR reaction was set up as per manufacturer’s instructions (Applied Biosystems™ 7500) with 50ng cDNA ...
-
bioRxiv - Immunology 2020Quote: ... Amplification reactions were set in triplicates and performed in a QuantStudio5 (Applied Biosystems) instrument with a first cycle of 10 min at 95°C followed by 40 cycles of amplification (15 s at 95°C and 1 min at 60°C) ...
-
bioRxiv - Cancer Biology 2019Quote: ... A set of pre-validated short interfering RNA (Silencer Select siRNA, Life Technologies) targeting EZR (Entrez Gene ID 7430 ...
-
bioRxiv - Genomics 2021Quote: ... Genotyping and array manufacturing for the screening set was performed by Thermo Fisher Scientific at Santa Clara ...
-
bioRxiv - Immunology 2022Quote: ... cells were permeabilized using the FoxP3/ transcription factor staining buffer set (Thermo Fisher) and then incubated with the following antibodies ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cryo-EM data sets were collected on a Titan Krios electron microscope (ThermoFisher) operated at 300 kV acceleration voltage with a Falcon II direct electron detector (ThermoFisher ...
-
bioRxiv - Cancer Biology 2024Quote: ... on-column DNAse treatment was performed with PureLink™ DNase Set (Invitrogen #12185010) according to the manufacturer’s protocol (page 63 ...
-
bioRxiv - Immunology 2022Quote: ... cells were fixed and permeabilized using the Transcription Factor Staining Buffer Set (ThermoFisher). Surface or intracellular staining was performed at 1x108 cells/mL for 20 mins at 4°C ...
-
bioRxiv - Neuroscience 2022Quote: ... Obtained data sets have been processed by compound discoverer 3.0 (Thermo Fisher Scientific). Compound annotation was with a mass accuracy of 3 ppm for precursor masses and 10 ppm for fragment ion masses search public spectral databases as well as our in-house spectral library ...
-
bioRxiv - Developmental Biology 2022Quote: ... Total RNA was treated with an RNase-Free DNase Set (ThermoFisher Scientific – EN0521). RNA concentrations were measured by NanoDrop (Thermo Scientific ...
-
bioRxiv - Immunology 2022Quote: ... cells were fixed and permeabilized using the FoxP3 staining buffer set (Thermo Scientific) according to manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... the eBioscience FoxP3/Transcription Factor staining buffer set (Invitrogen, Cat: 00-5523-00) was used according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... Reactions were set up using Fast SYBR Green Master Mix (Applied Biosystems: 4385612) and qRT-PCR gene-specific primers (Supplementary Table 4. ...
-
bioRxiv - Systems Biology 2023Quote: ... IL6 FISH mRNA probe set (VA6-12712-VC) was purchased from Thermo Scientific. CF 488A succinimidyl ester (SCJ4600018 ...