Labshake search
Citations for Thermo Fisher :
351 - 400 of 10000+ citations for rno mir 32 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Real time RT-qPCR was then performed using the AgPath RT-PCR (Life Technologies) kit on a QuantStudioTM 7 Flex Real-Time PCR System with the primers specific for SARS-CoV-2 E gene (35) ...
-
bioRxiv - Microbiology 2019Quote: ... Reverse transcription (RT) was performed with the ThermoScript™ RT-PCR System (ThermoFisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... miR-30a-3p (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2020Quote: ... hsa-mir-423-5p (Thermofisher) served as endogenous control for analysis of miRNA expression ...
-
bioRxiv - Neuroscience 2023Quote: ... the miR designer by Thermofisher was used ...
-
bioRxiv - Molecular Biology 2021Quote: ... RT-PCR was performed on ProFlex™ PCR (Thermo Fisher Scientific, USA) using DNA polymerase (QingkeBiotech ...
-
bioRxiv - Molecular Biology 2020Quote: ... qRT–PCR was performed using SuperScriptIII One-Step RT–PCR Kit (Invitrogen) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... qRT-PCR analyses were performed using SYBR Green RT-PCR kits (Invitrogen) on a Bio-Rad CFX Connect Real-Time system or Roche LightCycler ...
-
bioRxiv - Neuroscience 2023Quote: ... qRT-PCR was performed using an SYBR green RT-PCR kit (Affymetrix), using the Bio-Rad CFX96 Touch™ Real-Time PCR Detection System under the following conditions ...
-
bioRxiv - Cell Biology 2020Quote: ... and quantitative RT-PCR were from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Genetics 2021Quote: ... and RT-PCR Grade Water (Thermo Fisher Scientific) were used as positive and negative controls for each batch of genotyping ...
-
bioRxiv - Molecular Biology 2021Quote: ... in a StepOnePlus RT-PCR System (Thermo Fisher).
-
bioRxiv - Immunology 2019Quote: ... on a StepOne RT-PCR System (Applied Biosystems). Expression levels were normalized to Gapdh or 18S using the ΔCt method or ΔΔCt relative to control groups.
-
bioRxiv - Developmental Biology 2019Quote: ... RT-PCR products were cloned (TOPO-TA; Invitrogen), and the plasmids purified from individual colonies was/were Sanger-sequenced according to standard protocols to identify the precise alteration of the endogenous gclc transcript.
-
bioRxiv - Genetics 2020Quote: ... and RT-PCR Grade Water (Thermo Fisher Scientific) were used as the positive and negative controls ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... A one-step hemi-nested RT-PCR (Invitrogen) was used to detect coronavirus RNA using a set of primers targeting a 440-nt fragment of the RdRp gene and optimized for bat-CoV detection (CoV-FWD3 ...
-
bioRxiv - Cancer Biology 2020Quote: ... using a StepOnePlus RT-PCR system (Applied Biosystems). Reactions were run in triplicate and mouse Actb was used as a housekeeping gene ...
-
bioRxiv - Physiology 2020Quote: ... in a RT-PCR System (StepOnePlus, Applied Biosystems). PCR reactions were done in duplicate with the addition of negative controls (i.e. ...
-
bioRxiv - Molecular Biology 2020Quote: ... SuperScript IV One-step RT-PCR kit (ThermoFisher) was used for detection of transcripts ...
-
bioRxiv - Physiology 2019Quote: ... Taqman RT-PCR reagents (Applied Biosystems, Carlsbad, CA) were used to generate all cDNA ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 2.375 µl RT-PCR grade water (Invitrogen). PCR products were cleaned up with 0.8:1 Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Neuroscience 2020Quote: ... on a StepOnePlus RT PCR system (Applied Biosystems) or a LightCycler 96 (Roche) ...
-
bioRxiv - Microbiology 2021Quote: ... The SuperScript IV RT-PCR system (ThermoFisher Scientific) was used for generating cDNA according to manufacturer’s procedures and final PCR reactions were performed according to standard protocols.
-
bioRxiv - Immunology 2022Quote: ... RT-PCR was performed with StepOnePlus (Applied Biosystems) using SYBR Green PCR Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2022Quote: SuperScript IV One-Step RT-PCR System (Invitrogen) was used for RSV whole genome amplification with two separate multiplex RT-PCR reactions using six pairs of primers designed for this study ...
-
bioRxiv - Neuroscience 2023Quote: ... RT-PCR TaqMan gene expression assays (Applied Biosystems) were used to measure the expression of β-actin (ACTB) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and a StepOnePlus RT PCR system (Applied Biosystems). Relative gene expression levels were normalized to GAPDH ...
-
bioRxiv - Biochemistry 2024Quote: ... Using a QuantStudio 3 RT-PCR thermocycler (Invitrogen), the DSF samples were incubated at 5°C for 1 min ...
-
bioRxiv - Immunology 2024Quote: ... on a QuantStudio 5 RT-PCR (Applied Biosystems). Relative gene expression values were calculated using the delta-delta Ct method ...
-
bioRxiv - Immunology 2021Quote: ... RT-qPCR was carried out using the ViiA7 RT-qPCR system with TaqMan reagents using TaqMan primers/probes (Life Technologies) for EMCV 5′UTR (Table S1).
-
bioRxiv - Cancer Biology 2022Quote: ... MicroRNA was firstly transcribed by miRCURY LNA RT kit to obtain its cDNA and examined for the expression level by specific primers designed for miR-4776-5p (Applied Biosystems). The quantitative PCR was performed by the miRCURY LNA SYBR Green PCR KiT (Applied Biosystems ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... using 48 pairs of in-house DENV serotype-specific primers and the SuperScript III One-Step RT-PCR system with Platinum® Taq High Fidelity polymerase (ThermoFisher Scientific, MA, USA), followed by cDNA purification using Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 5’ TCTCGCTGGGGACTCTGGTTGAAAT 3’) primers (Eurofins, Louisville, KY) and SuperScript™ III One-Step RT-PCR kit with Platinum™ Taq DNA Polymerase (Invitrogen, Carlsbad, CA) using the following thermocycler conditions ...
-
bioRxiv - Physiology 2021Quote: ... mRNA levels were quantified using gene-specific primer pairs by real-time RT-PCR on an ABI PRISM 7900HT Sequence Detection System (Thermo Fisher Scientific, MA, US) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... quantitative RT-PCR (qRT-PCR) was done using Power SYBR PCR master mix (Thermo Fisher) and in technical triplicates each time.
-
bioRxiv - Cancer Biology 2022Quote: ... Real-time PCR (RT-PCR) was conducted using the TaqMan PCR Master Mix (Applied Biosystems), with glyceraldehyde-3-phosphate dehydrogenase (gapdh ...
-
bioRxiv - Cancer Biology 2022Quote: ... Quantitative RT-PCR (qRT-PCR) was performed using TaqMan Universal PCR Master Mix (Applied Biosystems) and TaqMan gene expression assays (Life Technologies ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was synthesized using an oligo(dT) primer and SuperScript III RT (Invitrogen). Template cDNA was diluted such that <30% of reactions were positive in the subsequent PCR ...
-
bioRxiv - Genomics 2021Quote: miRNAs were retro-transcribed with gene-specific primers and multiscribe RT (Life Technologies). Their levels of expression were measured with TaqMan probes (miRNA Taqman assays # 000546 for miR-335-5p ...
-
bioRxiv - Molecular Biology 2021Quote: ... First strand synthesis was performed with Random Primer and Superscript II RT (Invitrogen) at 25°C for 10 min ...
-
bioRxiv - Plant Biology 2024Quote: ... All primers used for the RT-qPCR analyses were synthesized by ThermoFisher (US) or IDT (Integrated DNA Technologies ...
-
bioRxiv - Plant Biology 2020Quote: ... The primers used for qRT-PCR were designed with Primer Express v3.0 software (ThermoFisher Scientific). The primers used for qRT-PCR are listed in Table S2.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Primers for PCR were designed using the Primer Express software version 3.0 (Applied Biosystems, USA). Sequences of PCR primer (in 5’→3’ direction ...
-
bioRxiv - Microbiology 2021Quote: ... and diagnostic PCRs were set using Taq Phusion DNA polymerase (Invitrogen). The TGME49_233160-HA parasite line was generated as part of an earlier study by tagging of the endogenous locus in the T ...
-
bioRxiv - Microbiology 2020Quote: ... Quantitative PCR was set up with Fast SYBR Green mix (Invitrogen) and using the Applied Biosystems™ 7500 Fast Real-Time PCR Instrument ...
-
bioRxiv - Microbiology 2021Quote: ... isolated from Aag2 cells was used as a template for RT-PCR performed using SSIII One-Step RT-PCR Kit with Platinum Taq (Invitrogen, USA) according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2020Quote: ... in 20 μL reactions using AgPath-ID™ One-Step RT-PCR Reagents 10 µl RT-PCR buffer (2X) (Thermo Fisher), 4 μL of RNA ...
-
bioRxiv - Immunology 2021Quote: ... The Real-time RT-PCR assays were conducted using TagMan One-Step RT-PCR kit (Thermo Fisher Scientific, Waltham, MA, USA) on Real-Time PCR System (Biorad ...
-
bioRxiv - Molecular Biology 2020Quote: ... being 10 μl of 2X RT-PCR Buffer and 0,8 μl of Enzyme Mix of the AgPath-ID™ One-Step RT-PCR Reagents (ThermoFisher™), 0,8 μl of each primer and 0,4 μl of probe for E gene [13] both in a 5 μM concentration ...
-
bioRxiv - Molecular Biology 2020Quote: ... 20 μl total volume being 10 μl of 2X RT-PCR Buffer and 0,8 μl of Enzyme Mix of the AgPath-ID™ One-Step RT-PCR Reagents (ThermoFisher™), 1,5 μl of primers + probe ...