Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for rno mir 32 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... Manual RT-qPCR was carried out using TaqMan primer/probes (Applied Biosystems) with data acquired on a ViiA Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Microbiology 2019Quote: ... The RT-PCR was performed using the SuperScript III Platinum One-Step Quantitative RT-PCR system (Invitrogen, Carlsbad, CA) on a LightCycler 480 instrument (Roche Diagnostics ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by sequencing via SuperScript III One-Step RT-PCR System with Platinum Taq RT-PCR (Life Technologies, USA) conducted by Life Technologies Biotechnology (Shanghai ...
-
bioRxiv - Microbiology 2020Quote: ... RT-PCR was performed using a Superscript III one-step RT-PCR system with platinum Taq DNA polymerase (Invitrogen) with four sets of specific primers ...
-
bioRxiv - Microbiology 2020Quote: ... RT-PCR was performed using a Superscript III one-step RT-PCR system with platinum Taq DNA polymerase (Invitrogen) with primers covering the entire S segment region according to a previously reported study [9] ...
-
bioRxiv - Molecular Biology 2019Quote: ... RT-PCRs were performed using the One-step Superscript III RT-PCR kit with Platinum Taq polymerase (Life Technologies) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... The RT-PCR was performed using the SuperScript III Platinum One-Step Quantitative RT-PCR system (Invitrogen, Carlsbad. CA) on a LightCycler 96 or LightCycler 480 instrument (Roche Diagnostics ...
-
bioRxiv - Cell Biology 2022Quote: ... with a one-step RT-PCR kit using Taqman® technology (AgPath-IDTM One-Step RT-PCR, Life Technologies) and using the Applied Biosystems ViiA 7 Real-Time PCR System and the appropriate primers for Taqman assays (Life Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... The RT-PCR was performed using the SuperScript III Platinum One-Step Quantitative RT-PCR system (Invitrogen, Carlsbad, CA) or Taqman Fast Virus 1-step master mix (Applied Biosystems ...
-
bioRxiv - Microbiology 2023Quote: ... A multi segment RT-PCR amplification was performed using the Superscript III high-fidelity RT-PCR Kit (Invitrogen, USA). Influenza virus specific primers were used ...
-
bioRxiv - Microbiology 2024Quote: Real-time RT-PCR was performed using AgPath-ID™ One-Step RT-PCR reagents (Applied Biosystems, Product # 4387424) on a StepOnePlus Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2021Quote: ... hippocampal neurons were transfected at DIV7 with 10nM of the miR-499-5p or control mimic (Ambion™ Pre-miR miRNA Precursor: miR-499-5p and Neg Control 1, Thermo Fisher) with the Lipofectamine RNAiMAX reagent (Thermo Fisher ...
-
bioRxiv - Immunology 2022Quote: ... and the 2019-nCoV RT-qPCR primers and probe (E_Sarbeco)84 on a StepOnePlus RealTime PCR System (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... 1 µg of RNA was used for reverse transcription by the M-MLV-RT (Life Technology) using oligo(dT) primer and qRT-PCR was performed on a Step One Plus system (Applied Biosystems Version 2.2.3) using SYBR Premix ExTaq reagents and protocol (Takara) ...
-
bioRxiv - Microbiology 2022Quote: RNA was amplified with influenza-specific primers (Hoffmann et al., 2001) using Invitrogen Superscript III One-Step RT-PCR with Platinum Taq (ThermoFisher Scientific, Waltham, USA). The simultaneous amplification of all influenza segments is based on a one-step RT-PCR method along with primers designed to bind to the conserved 3’ and 5’ ends of the segments ...
-
bioRxiv - Genomics 2020Quote: ... cDNA was reverse transcribed from total patient and control RNA samples using random hexamers primers from the SuperScript™ III First-Strand Synthesis System for RT-PCR kit (Invitrogen, Carlsbad, CA) according to manufacturer’s guidelines ...
-
bioRxiv - Molecular Biology 2020Quote: ... Reverse transcription was carried out using RT primer (TruSeq small RNA kit, RTP) and superscript III RT enzyme (Invitrogen). Library was amplified by 10–14 cycles of PCR using indexing primers (TruSeq small RNA kit ...
-
bioRxiv - Genomics 2020Quote: ... Gene sequences were obtained from Ensembl v92 (www.ensembl.org) and PCR primers (Supplementary Table 16) were designed using Primer Express Software for Real-Time PCR 3.0 (Applied Biosystems). Primer efficiency and specificity were evaluated on genomic DNA in each species ...
-
bioRxiv - Bioengineering 2021Quote: ... We first used the same primer sets and PowerUp SYBR Green MasterMix (Thermo Fisher, A25742) as in the qPCR reactions to amplify the samples for 25 cycles ...
-
bioRxiv - Neuroscience 2021Quote: ... 40X Taqman SNP genotyping assay and custom designed primer-probe set (Life Technologies, Table 1) was used to detect indels ...
-
bioRxiv - Immunology 2021Quote: ... and primers/probes sets targeting SIVmac239 (Eurofins Scientific, USA) or GAPDH (Thermo Fisher Scientific, USA). Reactions were completed in triplicates for 40 cycles using FAM dyes ...
-
bioRxiv - Molecular Biology 2021Quote: ... with specific set of primer pairs (Supp Table 1) using ViiA7 thermal cycler (Applied Biosystems). Changes in threshold cycles were calculated by subtracting the Ct values of the gene of interest from that of housekeeping control (for qRT-PCR ...
-
bioRxiv - Molecular Biology 2020Quote: ... All pcr primers were purchased from Thermo Fisher Scientific and are listed in Supplementary Table 4 and Table 5.
-
bioRxiv - Cell Biology 2023Quote: ... Target-specific PCR primers were obtained from ThermoFisher Life Technologies ...
-
bioRxiv - Neuroscience 2021Quote: ... Quantitative RT-PCR was performed using QuantiTect Probe RT-PCR Kit (Quiagen®) in a StepOne™ Real-Time PCR System (Thermo Fisher Scientific). Amplifications were carried out in 25 µL reaction mixtures containing 2X reaction mix buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... hsa-miR-25-3p or cel-miR-67 as control (25mM) using Oligofectamine (Invitrogen). Firefly and Renilla luciferase activities were measured using the Dual Luciferase Reporter Assay System (Promega) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 100 nM Anti-miR miRNA Inhibitor to hsa-miR-218 (Ambion, Inc., Austin, TX), or 100 nM FlexiTube siRNA to ARF6 (Qiagen ...
-
bioRxiv - Cancer Biology 2022Quote: ... and pre-miR miRNA mimics or pre-miR control 1 (all ThermoFisher, Leicestershire, UK). Luciferase activity was quantified at 24 hrs using the dual-glo luciferase assay system (Promega ...
-
bioRxiv - Microbiology 2023Quote: ... miR-19a (Assay ID: 000395) and miR-92a (Assay ID:000430) (Applied Biosystems, USA), as per manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... miR-16 mimic (miR-16; 50 nM; mirVana® miRNA mimic; MC10339; ThermoFisher Scientific), or the respective negative controls [Lincode Non-targeting Pool (CTR lncRNA ...
-
bioRxiv - Bioengineering 2023Quote: ... PCR employed the TaqMan Universal PCR Master Mix II with miR-specific Small RNA Assays (Thermo Fisher Scientific, Waltham, MA, USA), and proceeded according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2020Quote: ... Quantitative real-time RT-PCR (RT-qPCR) assays were performed using SYBR Green Realtime PCR Master Mix (Thermo Fisher Scientific) on an Eppendorf Real-time PCR System MasterCycler RealPlex instrument ...
-
bioRxiv - Microbiology 2020Quote: ... in 20 μl reactions using AgPath-ID One-Step RT-PCR Reagents 10 μl RT-PCR buffer (2X) (Thermo Fisher), 5μl of RNA ...
-
bioRxiv - Microbiology 2020Quote: ... One-step RT-PCR was performed using the Super-Script III One-Step RT-PCR System with Platinum Taq (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... The co-transcription was analyzed by RT-PCR using SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (Invitrogen), following the manufacturer’s instructions.
-
Genomic and phylogenetic analyses of SARS-CoV-2 strains isolated in the city of Gwangju, South KoreabioRxiv - Microbiology 2020Quote: ... 1 μL of 25X RT-PCR enzyme mixture included in AgPath-ID One-step RT-PCR Reagents (Thermo Fisher Scientific), 5 μL of RNA ...
-
bioRxiv - Microbiology 2021Quote: RT-PCRs were performed using a SuperScript III One-Step RT-PCR with Platinum Taq DNA Polymerase system (Thermo Fisher). Cycling conditions were as follows ...
-
bioRxiv - Microbiology 2021Quote: RT-PCRs were performed using the SuperScript III One-Step RT-PCR with Platinum Taq DNA Polymerase system (Thermo Fisher). Cycling conditions were as follows ...
-
bioRxiv - Microbiology 2021Quote: ... The RT-PCR was performed using either the SuperScript III Platinum One-Step Quantitative RT-PCR system (Invitrogen, Carlsbad, CA) or Taqman Fast Virus 1-step master mix (Applied Biosystems ...
-
bioRxiv - Immunology 2019Quote: ... Gene expression was quantified by quantitative RT-PCR using a StepOnePlus RT-PCR machine (Applied Biosystems, Foster City, CA, USA), TaqMan Fast Advanced Master Mix (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... double-stranded cDNA was synthesized by real-time reverse-transcription (RT-PCR) using Superscript III platinium One-step Quantitative RT-PCR System (Invitrogen) as described previously with minor modifications (Corman et al. ...
-
bioRxiv - Microbiology 2022Quote: ... This DNA-free RNA was then subjected to RT-PCR using the SuperScript III One-Step RT-PCR system with Platinum Taq DNA Polymerase kit (Invitrogen) with primers specific to the gene of interest (Supplementary Table 2).
-
bioRxiv - Microbiology 2022Quote: ... RT-PCR was performed in a 96-well plate using an Applied Biosystems QuantStudio 6 RT-PCR system (ThermoFisher Scientific). Reactions of 50 μLs in total volume were used which contained ...
-
bioRxiv - Microbiology 2023Quote: ... A total of 8.5 µL extracted RNA was subjected to one-step RT-PCR using the Superscript III one-step RT-PCR system (Invitrogen). The one-step RT-PCR was performed using the forward primer Pol F1 5’-TACAGTGCAGGGGAAAGAATA-3’ (nt 4809-4829 ...
-
bioRxiv - Molecular Biology 2023Quote: ... the TFAM mRNA was amplified by RT-PCR using the SuperScript IV One-Step RT-PCR System (Thermo Fisher Scientific). The RT-PCR reaction was further amplified by PCR using inner primers (Extended Table 1).
-
bioRxiv - Molecular Biology 2023Quote: ... RT-PCR was conducted using the Verso 1-Step RT-PCR Hot-Start kit (Thermo Fisher Scientific, Waltham, MA, USA). The primers used for RT-PCR were RGCP-NdeI-F (5’ ATGGCAAGGAAGAAGGGCAAATCGGCCA 3’ ...
-
bioRxiv - Synthetic Biology 2023Quote: ... DNA removal from RNA fractions was confirmed by RT-PCR using the SuperScript IV One-Step RT-PCR System (Invitrogen) with and without addition of SuperScript IV RT Mix ...
-
bioRxiv - Microbiology 2023Quote: ... A total of 8.5 µL extracted RNA was subjected to one-step RT-PCR using the Superscript III one-step RT-PCR system (Invitrogen). To amplify the pol region ...
-
bioRxiv - Molecular Biology 2023Quote: ... or used directly as a template for RT-PCR using SuperScript IV One-Step RT-PCR System (Cat# 12594100, Invitrogen).
-
bioRxiv - Immunology 2022Quote: ... SARS-CoV-2 detection was performed using real-time RT-PCR with a probe sets targeting Orf1b and S with FAM fluor (Life Technologies 4332079 assays # APGZJKF and #APXGVC4) multiplexed with an RNaseP probe set with VIC or HEX fluor (Life Technologies A30064 or IDT custom ...